Giter Site home page Giter Site logo
Shriram Bhat photo

artorias111 Goto Github PK

followers: 7.0 following: 16.0 repos: 52.0 gists: 3.0

Name: Shriram Bhat

Type: User

Company: University Of Illinois Urbana Champaign

Bio: CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA

Location: Champaign

Shriram Bhat's Projects

100linesofcode icon 100linesofcode

Let's build something productive in less than 100 Lines of Code.

colourcode icon colourcode

Import of http://colorcode.codeplex.com/ for our own evil purposes.

conan icon conan

Conan - The open-source C/C++ package manager

core icon core

Repository for libbiogears and all core utilities

darwin icon darwin

A simulator for natural selection

dictu icon dictu

Dictu is a simple dynamically typed programming language built upon the craftinginterpreters tutorial.

fastools icon fastools

Tools to work with fasta files. There's many, many better implementations, this is just my shot at it.

ping_bot icon ping_bot

A dependable discord bot that returns your ping when you ask nicely for it

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.