Another issue with ModelFinder: "ERROR: Alignment sequence XXX does not appear in the tree"

[iqtree]

Another issue with ModelFinder: "ERROR: Alignment sequence XXX does not appear in the tree"

[thomaskf]

Dear all,

Apology for the long delay. The issue has been identified and fixed.
Please refer to the updated release v2.2.0.2:
https://github.com/iqtree/iqtree2/releases/tag/v2.2.0.2

Thank you very much for reporting the issue.
Thomas

[thomaskf]

Thank you! We can simulate the problem using your alignment! We are checking and trying to fix the bug.
Cheers.

[lsjermiin]

The same error has occurred when analysing alignments of DNA

[Rob-murphys]

Bumping this, any news on a fix?

[lsjermiin]

No, I am still waiting for feedback from Minh Bui

[Rob-murphys]

Fingers crossed. It is only happening one a handful of the alignments I pass it so i am just excluding those gene trees from my species tree estimation. Or would you recommend moving to a stable version?

[lsjermiin]

I am not the right person to answer this. I was behind ModelFinder and GHOST, both of which are in IQ-TREE and IQ-TREE 2, but I didn't do the coding, so I can't answer you.
What I can say is that I get a number of errors with both version 1.6.12 and 2.1.3. Many of these occur during model selection and seems to be associated with complex models of rate heterogeneity across sites. This is frustrating because I am trying determine whether there is a better way to do model selection

[roblanf]

@thomaskf would you be able to take a look at this? Since we are finalising MF2 for publication it seems like a good time to chase down this bug.

[roblanf]

@lsjermiin, would you be able to send your input files to @thomaskf?

[thomaskf]

I will take a look on the problem. Will keep you all informed.

…

On 3/2/22 6:28 am, roblanf wrote: @lsjermiin <https://github.com/lsjermiin>, would you be able to send your input files to @thomaskf <https://github.com/thomaskf>? — Reply to this email directly, view it on GitHub <#47 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AENQCRTC4MFNAIIDDEZBTR3UZGAU5ANCNFSM5I5CPJ5Q>. Triage notifications on the go with GitHub Mobile for iOS <https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675> or Android <https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub>. You are receiving this because you were mentioned.Message ID: ***@***.***>

[thomaskf]

Hi all, It seems that the input data set belongs to another research team and so it is not available for us to replicate and identify the problem. Is there another data set which is available and has had the similar problem when running the iqtree on it? Thanks, Thomas

…

On 3/2/22 6:28 am, roblanf wrote: @lsjermiin <https://github.com/lsjermiin>, would you be able to send your input files to @thomaskf <https://github.com/thomaskf>? — Reply to this email directly, view it on GitHub <#47 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AENQCRTC4MFNAIIDDEZBTR3UZGAU5ANCNFSM5I5CPJ5Q>. Triage notifications on the go with GitHub Mobile for iOS <https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675> or Android <https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub>. You are receiving this because you were mentioned.Message ID: ***@***.***>

[lsjermiin]

OK -- I found the original file; this is one data set, of several, where this problem occurs

[thomaskf]

Thanks! Will look into it!

…

On 3/2/22 4:17 pm, lsjermiin wrote: OK -- I found the original file; this is one data set, of several, where this problem occurs — Reply to this email directly, view it on GitHub <#47 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AENQCRW7LDTVDCODUJI65VTUZIFYNANCNFSM5I5CPJ5Q>. Triage notifications on the go with GitHub Mobile for iOS <https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675> or Android <https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub>. You are receiving this because you were mentioned.Message ID: ***@***.***>

[Chjulian]

Any solution to this?
I encounter the issue too often with/without -keep-ident

[roblanf]

@thomaskf can we replicate the error yet?

@Chjulian, if you're able to send us your dataset (off list, we will not share it with anyone, of course), it would really help us to fix this bug. I understand if not though!

[thomaskf]

Hi all,

I have been checking this error since last week. I found that I didn't see the problem if I compiled the IQ-Tree from the source codes. However, the problem appeared if I downloaded and used the binary file. Can some of you try to compile the IQ-Tree from the source codes and see whether the problem still exists? The compilation procedure is stated inside the user manual. I will continue to check why the problem exists when using the binary file, but this may need some time.
Thank you very much!

Thomas

[lsjermiin]

Dear Thomas, I’ll check this out and let you know. I did indeed download the binaries for v1.6.12, v2.1.3, and v2.2.0-beta. I’ll try to download and compile the source code after tomorrow’s lecture is done. Thanks for tracing this bug – it has bothered me for months now. All the best, Lars From: Thomas Wong ***@***.***> Reply to: iqtree/iqtree2 ***@***.***> Date: Wednesday, 23 February 2022 at 09:49 To: iqtree/iqtree2 ***@***.***> Cc: Lars Jermiin ***@***.***>, Mention ***@***.***> Subject: Re: [iqtree/iqtree2] Another issue with ModelFinder: "ERROR: Alignment sequence XXX does not appear in the tree" (Issue #47) Hi all, I have been checking this error for a week. I found that I didn't see the problem if I compiled the IQ-Tree from the source codes. However, the problem appeared if I downloaded and used the binary file. Can some of you try to compile the IQ-Tree from the source codes and see whether the problem still exists? The compilation procedure is stated inside the user manual. I will continue to check why the problem exists when using the binary file, but this may need some time to fix. Thank you very much! Thomas — Reply to this email directly, view it on GitHub<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fiqtree%2Fiqtree2%2Fissues%2F47%23issuecomment-1048606933&data=04%7C01%7Clars.jermiin%40anu.edu.au%7C4a220c6acd8a46da836708d9f6b1cf7e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637812065823755658%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=jUqxBir4ph6ksE0T9gJizwFWdJiW5N8nmBjO%2FH9UG7s%3D&reserved=0>, or unsubscribe<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAG6JXEDG4CSQOR6UJKMKFD3U4SUTBANCNFSM5I5CPJ5Q&data=04%7C01%7Clars.jermiin%40anu.edu.au%7C4a220c6acd8a46da836708d9f6b1cf7e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637812065823755658%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=Oucm8%2FHc1yEMnDjLLtxdjwE4vmHgvqdlCJc2clqEfvI%3D&reserved=0>. Triage notifications on the go with GitHub Mobile for iOS<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fapps.apple.com%2Fapp%2Fapple-store%2Fid1477376905%3Fct%3Dnotification-email%26mt%3D8%26pt%3D524675&data=04%7C01%7Clars.jermiin%40anu.edu.au%7C4a220c6acd8a46da836708d9f6b1cf7e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637812065823755658%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=BwNEqHmEMsyfmnfA5%2BkRV1McH7DxzQXYI%2FUFXuGQGS0%3D&reserved=0> or Android<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fplay.google.com%2Fstore%2Fapps%2Fdetails%3Fid%3Dcom.github.android%26referrer%3Dutm_campaign%253Dnotification-email%2526utm_medium%253Demail%2526utm_source%253Dgithub&data=04%7C01%7Clars.jermiin%40anu.edu.au%7C4a220c6acd8a46da836708d9f6b1cf7e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637812065823755658%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=wc3w4%2FYVkOfUE3r80bUhiNdZxWmwNdhrj6C55WnQO4Q%3D&reserved=0>. You are receiving this because you were mentioned.Message ID: ***@***.***>

[thomaskf]

Just a quick note. To download and compile the latest version of IQ-Tree, you may use the following commands:

git clone --recursive https://github.com/iqtree/iqtree2
cd iqtree2
mkdir build
cd build
cmake -DUSE_LSD2=ON ..
make -j

Hope this helps.

Thomas

[Chjulian]

Dear Thomas,
I tried the source code and encountered the bug today.

IQ-TREE multicore version 2.2.0-beta COVID-edition for Mac OS X 64-bit built Feb 24 2022 built Feb 24 2022

ERROR: Alignment sequence HXB2 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_84_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_51_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_18_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_75_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_78_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_5_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_74_3.53424657534247 does not appear in the tree
ERROR: Tree taxa and alignment sequence do not match (see above)

ATM, I use a different simulated dataset each time so I do not have the alignment saved. I tweaked the code today so the last alignment is saved (in case the bug occurs again). I am also trying to see if I can reproduce the bug with one of my real datasets. It happened before but, TBH, is a bit puzzling as it seems to occur randomly with any dataset.

Cheers
J

[thomaskf]

Dear J,
Can I confirm whether you have got the latest version of the source codes by using the command:
git clone --recursive https://github.com/iqtree/iqtree2
or you downloaded the source codes from the release section?
I asked this because there was a recent update a few days ago. If you downloaded the source codes from the release section, the last update may not be included.

[Chjulian]

Dear Thomas, I confirm I got the latest version. I followed your instructions:

git clone --recursive https://github.com/iqtree/iqtree2
cd iqtree2
mkdir build
cd build
cmake -DUSE_LSD2=ON ..
make -j

[Chjulian]

Hey Thomas, the simulation reported the bug a min ago. I have now a dataset that triggers the bug often:

XXXX$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6
IQ-TREE multicore version 2.2.0-beta COVID-edition for Mac OS X 64-bit built Feb 24 2022 built Feb 24 2022
Developed by Bui Quang Minh, James Barbetti, Nguyen Lam Tung,
Olga Chernomor, Heiko Schmidt, Dominik Schrempf, Michael Woodhams, Ly Trong Nhan.

Host:    MACB0141 (AVX2, FMA3, 8 GB RAM)
Command: iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6
Seed:    938117 (Using SPRNG - Scalable Parallel Random Number Generator)
Time:    Fri Feb 25 12:10:49 2022
Kernel:  AVX+FMA - 2 threads (4 CPU cores detected)

Reading alignment file sim.fasta ... Fasta format detected
Reading fasta file: done in 0.000298977 secs using 78.6% CPU
(...)
(...)
BEST SCORE FOUND : -454.792
Total tree length: 0.019

Total number of iterations: 1046
CPU time used for tree search: 2.931 sec (0h:0m:2s)
Wall-clock time used for tree search: 2.047 sec (0h:0m:2s)
Total CPU time used: 2.958 sec (0h:0m:2s)
Total wall-clock time used: 2.066 sec (0h:0m:2s)

Analysis results written to: 
 IQ-TREE report:                sim.fasta.iqtree
 Maximum-likelihood tree:       sim.fasta.treefile
 Likelihood distances:          sim.fasta.mldist
 Screen log file:               sim.fasta.log

Date and Time: Fri Feb 25 12:10:52 2022

XXXX$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6
IQ-TREE multicore version 2.2.0-beta COVID-edition for Mac OS X 64-bit built Feb 24 2022 built Feb 24 2022
Developed by Bui Quang Minh, James Barbetti, Nguyen Lam Tung,
Olga Chernomor, Heiko Schmidt, Dominik Schrempf, Michael Woodhams, Ly Trong Nhan.

Host:    MACB0141 (AVX2, FMA3, 8 GB RAM)
Command: iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6
Seed:    195535 (Using SPRNG - Scalable Parallel Random Number Generator)
Time:    Fri Feb 25 12:14:22 2022
Kernel:  AVX+FMA - 2 threads (4 CPU cores detected)

Reading alignment file sim.fasta ... Fasta format detected
(...)
(...)
Computing RapidNJ tree took 0.000216 sec (of wall-clock time) 0.000356 sec (of CPU time)
ERROR: Alignment sequence HXB2 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_78_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_69_3.53424657534247 does not appear in the tree
(ID_source_pot1_sampled_62_3.53424657534247,ID_source_pot1_sampled_63_3.53424657534247,((ID_source_pot1_sampled_48_3.53424657534247,ID_source_pot1_sampled_44_3.53424657534247),((ID_source_pot1_sampled_83_3.53424657534247,ID_source_pot1_sampled_28_3.53424657534247),ID_source_pot1_sampled_10_3.53424657534247)));
ERROR: Tree taxa and alignment sequence do not match (see above)

[Chjulian]

I also tested it in another machine with a fresh installation (as per the instructions above). Same result (sometimes it works, often it does not):

imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
ERROR: Alignment sequence HXB2 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_78_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_69_3.53424657534247 does not appear in the tree
ERROR: Tree taxa and alignment sequence do not match (see above)
imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
ERROR: Alignment sequence HXB2 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_78_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_69_3.53424657534247 does not appear in the tree
ERROR: Tree taxa and alignment sequence do not match (see above)
imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
ERROR: Alignment sequence HXB2 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_78_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_69_3.53424657534247 does not appear in the tree
ERROR: Tree taxa and alignment sequence do not match (see above)
imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
imac$ iqtree2 -s sim.fasta -m MFP -T 2 -allnni -ninit 1000 -ntop 200 -nbest 50 -nstop 1000 --perturb 0.1 --redo-tree --radius 6 -quiet
ERROR: Alignment sequence HXB2 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_78_3.53424657534247 does not appear in the tree
ERROR: Alignment sequence ID_rec_pot1_sampled_69_3.53424657534247 does not appear in the tree
ERROR: Tree taxa and alignment sequence do not match (see above)

This is the data:

>HXB2
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_48_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTATCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATCAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_44_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_72_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_4_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_62_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAAAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_63_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAAAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_10_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAGAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_83_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATACTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_source_pot1_sampled_28_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATACTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_78_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_69_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_48_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_44_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_85_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_90_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_72_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_12_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_64_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_32_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_61_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_24_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC
>ID_rec_pot1_sampled_14_3.53424657534247
CTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATATGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC

I hope it thelps,
Cheers

[lsjermiin]

Dear Thomas, I followed the commands given below on the cluster that we are working on here, and got the following error (see below). All the best, Lars : mkdir build ***@***.*** iqtree2]$ cd build/ ***@***.*** build]$ cmake -DUSE_LSD2=ON ..

…

-- The C compiler identification is GNU 4.8.5

-- The CXX compiler identification is GNU 4.8.5

-- Check for working C compiler: /usr/bin/cc

-- Check for working C compiler: /usr/bin/cc -- works

-- Detecting C compiler ABI info

-- Detecting C compiler ABI info - done

-- Check for working CXX compiler: /usr/bin/c++

-- Check for working CXX compiler: /usr/bin/c++ -- works

-- Detecting CXX compiler ABI info

-- Detecting CXX compiler ABI info - done CMake Warning at CMakeLists.txt:68 (find_package): By not providing "FindEigen3.cmake" in CMAKE_MODULE_PATH this project has asked CMake to find a package configuration file provided by "Eigen3", but CMake did not find one. Could not find a package configuration file provided by "Eigen3" with any of the following names: Eigen3Config.cmake eigen3-config.cmake Add the installation prefix of "Eigen3" to CMAKE_PREFIX_PATH or set "Eigen3_DIR" to a directory containing one of the above files. If "Eigen3" provides a separate development package or SDK, be sure it has been installed. CMake Error at CMakeLists.txt:70 (message): Eigen3 library not found. Either install it or rerun cmake with -DEIGEN3_INCLUDE_DIR=<installed_eigen3_dir>

-- Configuring incomplete, errors occurred! See also "/home/people/ljermiin/bin/iqtree2/build/CMakeFiles/CMakeOutput.log". From: "Ch. Julian Villabona Arenas" ***@***.***> Reply to: iqtree/iqtree2 ***@***.***> Date: Friday, 25 February 2022 at 11:58 To: iqtree/iqtree2 ***@***.***> Cc: Lars Jermiin ***@***.***>, Mention ***@***.***> Subject: Re: [iqtree/iqtree2] Another issue with ModelFinder: "ERROR: Alignment sequence XXX does not appear in the tree" (Issue #47) Dear Thomas, I confirm I got the latest version. I followed your instructions: git clone --recursive https://github.com/iqtree/iqtree2 cd iqtree2 mkdir build cd build cmake -DUSE_LSD2=ON .. make -j — Reply to this email directly, view it on GitHub<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fiqtree%2Fiqtree2%2Fissues%2F47%23issuecomment-1050791541&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cabd0d56cc12141cc631908d9f856327f%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637813871362748937%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=8%2BHVa%2F4z0cMJTSJSC%2BNBDdOnNBM0cz1VcyWq%2BZ7Y9mI%3D&reserved=0>, or unsubscribe<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAG6JXEH6VXEQNXJYGSFWLT3U45VHXANCNFSM5I5CPJ5Q&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cabd0d56cc12141cc631908d9f856327f%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637813871362748937%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=gbIKV8A%2FxtQKn8V5DJP6zIn2y0yyhf7plkTkZEBtdEE%3D&reserved=0>. Triage notifications on the go with GitHub Mobile for iOS<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fapps.apple.com%2Fapp%2Fapple-store%2Fid1477376905%3Fct%3Dnotification-email%26mt%3D8%26pt%3D524675&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cabd0d56cc12141cc631908d9f856327f%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637813871362748937%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=Nejm4vKenBu0xVEmmFeYmMxt93O2gSpfi4Qu5rp9EiY%3D&reserved=0> or Android<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fplay.google.com%2Fstore%2Fapps%2Fdetails%3Fid%3Dcom.github.android%26referrer%3Dutm_campaign%253Dnotification-email%2526utm_medium%253Demail%2526utm_source%253Dgithub&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cabd0d56cc12141cc631908d9f856327f%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637813871362748937%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=eQ5Gfp5e6PgOceQldd9OrpApF0mT4vuFjBBaxJAJve0%3D&reserved=0>. You are receiving this because you were mentioned.Message ID: ***@***.***>

[roblanf]

Hi @lsjermiin,

I think this is probably fixable by installing the eigen3 library like this:

sudo apt install libeigen3-dev

(e.g. https://askubuntu.com/questions/860207/how-to-install-eigen-3-3-in-ubuntu-14-04)

But it would probably be worth just chatting with the sysadmin first.

Rob

[lsjermiin]

Thanks Rob. Have asked Sysadmin for input before installing it on local cluster. LArs From: roblanf ***@***.***> Reply to: iqtree/iqtree2 ***@***.***> Date: Monday, 28 February 2022 at 23:05 To: iqtree/iqtree2 ***@***.***> Cc: Lars Jermiin ***@***.***>, Mention ***@***.***> Subject: Re: [iqtree/iqtree2] Another issue with ModelFinder: "ERROR: Alignment sequence XXX does not appear in the tree" (Issue #47) Hi @lsjermiin<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Flsjermiin&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cfd153c6c62f7437c67c708d9fb0ee12d%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637816863588427252%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=aFOPLSxUG2moCCcnvSG%2FcgdF3qQbM9%2FxePKoGdCo7Pw%3D&reserved=0>, I think this is probably fixable by installing the eigen3 library like this: sudo apt install libeigen3-dev (e.g. https://askubuntu.com/questions/860207/how-to-install-eigen-3-3-in-ubuntu-14-04<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Faskubuntu.com%2Fquestions%2F860207%2Fhow-to-install-eigen-3-3-in-ubuntu-14-04&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cfd153c6c62f7437c67c708d9fb0ee12d%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637816863588427252%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=wAakQjL9u3xLI4QQnSxe1iyAgJv8hPAWsQuQwMQlONs%3D&reserved=0>) But it would probably be worth just chatting with the sysadmin first. Rob — Reply to this email directly, view it on GitHub<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fiqtree%2Fiqtree2%2Fissues%2F47%23issuecomment-1054786864&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cfd153c6c62f7437c67c708d9fb0ee12d%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637816863588427252%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=PQwiiHtLKesXeecoQmF2GQIoCQLLrtRHNTrnmip5jq4%3D&reserved=0>, or unsubscribe<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAG6JXEG3SLTP2XDKV2HPXLDU5VGNFANCNFSM5I5CPJ5Q&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cfd153c6c62f7437c67c708d9fb0ee12d%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637816863588427252%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=3GIIMLFPJ086PWp7e%2BJRPh2CkGuhejF24hcUxB26LRY%3D&reserved=0>. Triage notifications on the go with GitHub Mobile for iOS<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fapps.apple.com%2Fapp%2Fapple-store%2Fid1477376905%3Fct%3Dnotification-email%26mt%3D8%26pt%3D524675&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cfd153c6c62f7437c67c708d9fb0ee12d%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637816863588427252%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=sG9isOk7A7%2FbhDMgFZoHjRMJ2An2h7anlL9bW1Sbrlw%3D&reserved=0> or Android<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fplay.google.com%2Fstore%2Fapps%2Fdetails%3Fid%3Dcom.github.android%26referrer%3Dutm_campaign%253Dnotification-email%2526utm_medium%253Demail%2526utm_source%253Dgithub&data=04%7C01%7Clars.jermiin%40anu.edu.au%7Cfd153c6c62f7437c67c708d9fb0ee12d%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637816863588582931%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000&sdata=gSl9K1oRiTHJT8b%2BCVFiIZCkgTi6pI%2BVp1W94dRBgAE%3D&reserved=0>. You are receiving this because you were mentioned.Message ID: ***@***.***>

[lsjermiin]

Well done!!! Lars From: Thomas Wong ***@***.***> Reply to: iqtree/iqtree2 ***@***.***> Date: Thursday, 21 April 2022 at 10:22 To: iqtree/iqtree2 ***@***.***> Cc: Lars Jermiin ***@***.***>, Mention ***@***.***> Subject: Re: [iqtree/iqtree2] Another issue with ModelFinder: "ERROR: Alignment sequence XXX does not appear in the tree" (Issue #47) Dear all, Apology for the long delay. The issue has been identified and fixed. Please refer to the updated release v2.2.0.2: https://github.com/iqtree/iqtree2/releases/tag/v2.2.0.2<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fiqtree%2Fiqtree2%2Freleases%2Ftag%2Fv2.2.0.2&data=05%7C01%7Clars.jermiin%40anu.edu.au%7Ca4ed3ca6c8ba4dbfe7c708da2378841e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637861297764341979%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=2t23BwXpZC7DcFnC0U8EKo1C7Ga%2Flc40xpId27fzsGA%3D&reserved=0> Thank you very much for reporting the issue. Thomas — Reply to this email directly, view it on GitHub<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fiqtree%2Fiqtree2%2Fissues%2F47%23issuecomment-1104940447&data=05%7C01%7Clars.jermiin%40anu.edu.au%7Ca4ed3ca6c8ba4dbfe7c708da2378841e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637861297764341979%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=aLTvyDNit1Zn5IZwFf0vhmHgKPHA%2Ff2BeDNlE5n0Gds%3D&reserved=0>, or unsubscribe<https://aus01.safelinks.protection.outlook.com/?url=https%3A%2F%2Fgithub.com%2Fnotifications%2Funsubscribe-auth%2FAG6JXEBYL65P5TLFR7LO26DVGEM6XANCNFSM5I5CPJ5Q&data=05%7C01%7Clars.jermiin%40anu.edu.au%7Ca4ed3ca6c8ba4dbfe7c708da2378841e%7Ce37d725cab5c46249ae5f0533e486437%7C0%7C0%7C637861297764341979%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=7C4vEmjfN866S3r4q3Ek8OsZVAgnRKuB4qhmw2sa6Ds%3D&reserved=0>. You are receiving this because you were mentioned.Message ID: ***@***.***>