Giter Site home page Giter Site logo

bug with ISIZE numbers in .sam ? about rna-star HOT 4 OPEN

tba123 avatar tba123 commented on September 27, 2024
bug with ISIZE numbers in .sam ?

from rna-star.

Comments (4)

GoogleCodeExporter avatar GoogleCodeExporter commented on September 27, 2024
Hi Vladimir,

thanks for reporting this error, it looks like a bug.
Could you please extract the sequence of both mates from fastq files for
one of the problematic reads, and send them to me.
I will try to replicate the problem. Also, please let me know which genome
are you mapping to.

For a faster response, please post your questions in the STAR forum 
https://groups.google.com/d/forum/rna-star, or e-mail me directly at 
[email protected] 

Cheers
Alex

Original comment by [email protected] on 8 Apr 2014 at 6:17

  • Changed state: Accepted

from rna-star.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 27, 2024
Hi Alex,

thanks for your response!

this time I tested with star231o version. sorry, don't have in hand now my 
previous outputs. hope to send you later. mapping done against hg19.  

here is one problematic line in sam:
HWI-ST1149:193:C4309ACXX:5:2204:20157:21098 99  chr1    26140610    3   34S17M  =   26140585
    18446744073709551614    TGTTCTGCAGTTCCTCCAGAAGCTGGCTGGCCCTCACCTGGAGAAGTACAG @@@DDD
DABF?AFFHEGEHGFGGH@@EFHE8CFFHEDDHB;BB?DE8BF>?   NH:i:2  HI:i:2  AS:i:20 nM:i:2

here are 2 reads from input fastq files:

@HWI-ST1149:193:C4309ACXX:5:2204:20157:21098 1:N:0:GCCAAT
TGTTCTGCAGTTCCTCCAGAAGCTGGCTGGCCCTCACCTGGAGAAGTACAG
+
@@@DDDDABF?AFFHEGEHGFGGH@@EFHE8CFFHEDDHB;BB?DE8BF>?
@HWI-ST1149:193:C4309ACXX:5:2204:20157:21098 2:N:0:GCCAAT
TGGAAGCTGTACTTCTCCAGGTGAGGGCCAGCCAGCTTCTGGAGGAACTGC
+
+:=A?BDDF?DFFGIIFIFIIFFEFFFIBGEGGF?BGIIIIIGIEIIIIII

a few more examples you can find in attachment.

hope it helps.

Vladimir

Original comment by [email protected] on 9 Apr 2014 at 5:23

Attachments:

from rna-star.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 27, 2024
Dear Alex,

is there any chance to move on with this issue? Sorry to be impatient I hope 
you will have time to take a look at the problem.

Thanks.

Vladimir

Original comment by [email protected] on 15 Apr 2014 at 9:56

from rna-star.

GoogleCodeExporter avatar GoogleCodeExporter commented on September 27, 2024
Dear Alex,

your new patch (STAR_2.3.1y1) has solved the problem and now I got all my read 
counts from STAR-generated alignments with HTSeq-count without any errors.

Thanks a lot for your great job, kind and quick support!

Vladimir

Original comment by [email protected] on 17 Apr 2014 at 9:09

from rna-star.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.