This is a simple code in python to tell if a given sequence is DNA, RNA or neither. Also it provides the option of looking for a motif in the given sequence
The usage consist in calling the program (seqClass.py) in python and giving the sequence to be analyzed after the flag -s or --seq, and optionally give the motif to be found after the
flag -m or --motif.
Example: in the command line, type: python seqClass.py -s ATCTAGCTGATGCTAGCTGAC -m TAGC
antoniojperezcastro / git_handson Goto Github PK
View Code? Open in Web Editor NEWa public repository to play with remote git for the UVIC master's in omics