Automated DubSeq data analysis.
./dubdub.sh -d <results directory> -f <fastq.gz directory> -l <barseq layout table> -L <library> [-U <pre-sequence> -P <pre-sequence position> -D <post-sequence> -t <time0 read count cutoff>]
to run pipeline in the results directory using the specified fastq.gz directory barcode sequencing files and barseq layout table on the specified DubSeq library. Parameters in brackets are optional and are by default obtained from config.sh
. Note that it is not necessary to run the pipeline from within the DubDub directory, i.e. any valid path to dubdub.sh
works.
Analysis based on Mutalik et al. (2019), DOI 10.1038/s41467-018-08177-8 and DubSeq version f452baa.
Linux operating system (Tested on Ubuntu 18.04.5 LTS, Ubuntu 20.04.1 LTS, and Linux Mint 18)
bash 4.0 (Tested with 4.4.20(1)-release and 5.0.17(1)-release)
Python 3.5 (Tested with 3.5.2, 3.5.4 and 3.7.6)
R โฅ 3.6.3 (Tested with 3.6.3)
GNU parallel 20161222 (Tested with 20161222)
Python libraries: numpy, scipy, pandas, sklearn
R libraries: tidyverse, ggrepel, scales
Run the following in a terminal to download the DubDub pipeline into the directory dubdub
:
git clone https://github.com/Asplund-Samuelsson/dubdub
Installation of the pipeline takes approximately 15 seconds depending on connection speed.
To run DubDub on a DubSeq dataset, it is necessary to provide gzipped FASTQ (fastq.gz
) files and a barseq layout table describing the samples, as well as specifying a BagSeq library ("BPAG" and GFF files). If different from the defaults configured in config.sh
, it is also necessary to provide the correct upstream (pre-) and downstream (post-) sequences adjacent to the barcodes, as well as the expected beginning position of the upstream sequence.
Before beginning the demonstration, make sure that the dubdub
directory is the current working directory in your terminal:
cd dubdub
Now, first take a look at the compressed example FASTQ files in example/data
:
ls -1 example/data
10_S10_L002_R1_001.fastq.gz
15_S15_L002_R1_001.fastq.gz
16_S16_L002_R1_001.fastq.gz
17_S17_L002_R1_001.fastq.gz
18_S18_L002_R1_001.fastq.gz
19_S19_L002_R1_001.fastq.gz
1_S1_L001_R1_001.fastq.gz
1_S1_L002_R1_001.fastq.gz
1_S1_L003_R1_001.fastq.gz
1_S1_L004_R1_001.fastq.gz
28_S28_L002_R1_001.fastq.gz
45_S45_L002_R1_001.fastq.gz
46_S46_L002_R1_001.fastq.gz
The pipeline assumes that each fastq.gz
file name contains of four underscore-separated fields before the file extension, as in the output from multiple Illumina sequencing lanes. In the first listed file, those fields are S10_L002_R1_001
. Everything after the fourth underscore, counting from the end, is assumed to be the sample name (which may include underscores). In the first listed file, the sample name is 10
.
All fastq.gz
files in the input directory will be concatenated per sample in a new directory when the pipeline is running. This is to allow supplying files that are separated by lanes. An example of multiple lanes for the same sample is seen for sample 1
above. The fastq.gz
files may be provided in any number per sample and in any sub-directory structure; The pipeline will find them all.
Now take a look at how sample information should be provided in the tab-delimited barseq layout file:
cat example/example_barseq_layout.tab
sample type name
1 stress Nickel (II) chloride hexahydrate, 1.2mM
10 LB LB
15 stress Sodium nitrate, 200mM
16 stress Sodium nitrate, 300mM
17 stress Sisomicin sulfate salt, 0.001mg/ml
18 stress Sisomicin sulfate salt, 0.0025mg/ml
19 stress Sisomicin sulfate salt, 0.005mg/ml
28 LB LB
45 Time0 Time0
46 Time0 Time0
The example data is a chimeric dataset with barcodes from one experiment and sub-sampled sequencing data from Mutalik et al. (2019), DOI 10.1038/s41467-018-08177-8. The results will not make any biological sense, but similar samples should in general cluster in the PCA that is run automatically by DubDub. Time0
or stress
must be provided in the type
column and denote untreated and treated samples, respectively.
Next, inspect the example
library provided in DubDub:
ls libraries/example
example.bpag.tab example.gff
The "BPAG" file example.bpag.tab
contains BagSeq mappings of barcodes to genomic fragments generated by the DubSeq bpag.py
script, while the GFF file example.gff
contains genome annotations. Check how these files should be structured:
head -5 libraries/example/example.*
==> libraries/example/example.bpag.tab <==
barcode_up barcode_dn bpair_count pos_from pos_end region_len recommended up_read_count up_contig_id up_pos up_strand dn_read_count dn_contig_id dn_pos dn_strand
CTCGGTGTTGCGGGTCCGCC CCATTGAGATTCGCCTCCGG 2 1166684 1174542 7859 + 53 Chromosome 1166684 + 45 Chromosome 1174542 -
GAAAGAGCGTGGTGCATTAG TACCGGCATGGTGTGGGGCG 4 907275 848991 -58283 - 154 Chromosome 848991 - 114 Chromosome 907275 +
AGGCGATCTTAGGGGCAGAT GGCGTCTCGGTCCAGTAACC 49 3520019 2169440 -1350578 - 254 Chromosome 3520019 + 238 Chromosome 2169440 -
GGGCGGGGTATAGACCTGTC GTGTGAGTGATGGTGCCTAC 16 37586 44706 7121 + 77 Chromosome 37586 + 72 Chromosome 44706 -
==> libraries/example/example.gff <==
Chromosome Custom gene -200 772 . + 0 product=prenyltransferase;locus_tag=slr0611;ID=SGL_RS01875
Chromosome Custom gene 811 1494 . + 0 product=hypothetical protein;locus_tag=slr0612;ID=SGL_RS01880
Chromosome Custom gene 1577 2098 . + 0 product=hypothetical protein;locus_tag=slr0613;ID=SGL_RS01885
Chromosome Custom gene 2172 2873 . - 0 product=Ycf53-like protein;locus_tag=sll0558;ID=SGL_RS01890
Chromosome Custom gene 3192 4268 . - 0 product=magnesium-protoporphyrin IX monomethyl ester;locus_tag=sll1214;ID=SGL_RS01895
Note that the contig ID columns must contain matching IDs, and both the locus_tag
and ID
attributes in the ninth GFF column will be used by the pipeline. A new library may be set up manually and called by dubdub.sh
.
The demonstration example below takes 2 minutes and 30 seconds to run on a dual core 1.5 GHz system with 4 GB RAM. This command will run the DubDub pipeline in the directory example/results
, which will be created automatically:
./dubdub.sh -d example/results -f example/data -l example/example_barseq_layout.tab -L example -U CAGCGTACG -P 14 -D AGAGACC
Note that non-default upstream and downstream sequences are needed for the example library. A default set of values may be written in the config.sh
file, allowing the user to skip supplying the -U
, -P
, and -D
flags for each run.
The pipeline will store seven files in the specified output directory:
ls -1 example/results
gene_score_PCA.pdf
gene_scores.tab
intermediate_data.tar.gz
layout.tab
layout.valid.tab
sample_itnum.tab
valid_samples.txt
The gene_score_PCA.pdf
plots PCA results based on the NNLS gene fitness scores for all samples. The gene_scores.tab
table contains all fitness scores for each gene in all samples. The compressed archive intermediate_data.tar.gz
contains intermediate files and may be deleted to save space. The layout.tab
table is a copy of the supplied barseq layout table, but with 'itnum' IDs instead of sample IDs. The layout.valid.tab
contains only valid samples, i.e. those with at least one barcode that is "recommended" and has at least 10 time zero reads. The sample_itnum.tab
table maps 'itnum' IDs to the original sample IDs. The valid_samples.txt
file lists the valid samples (see above).
The PCA clustering analysis should look like this:
To use a new library with DubDub, it is necessary to create a directory under libraries
with the name of the new library, and two files also labeled with the library name. Let's use the 7002
library as an example, but we will call it Syn7002
instead:
mkdir libraries/Syn7002
Populate the new library with a "BPAG" file that has been created with the DubSeq bpag.py
script:
cp libraries/7002/7002.bpag.tab libraries/Syn7002/Syn7002.bpag.tab
The GFF file for the genome of interest may be generated with a GenBank file matching the genome used to generate the "BPAG" file:
source/genbank_to_gff.py libraries/7002/7002.gb libraries/Syn7002/Syn7002.gff
The GFF file is specifically designed to work with the DubDub and DubSeq scripts and a differently sourced GFF file may not work.
Once the library has been populated with a "BPAG" and GFF file, it is ready for use with dubdub.sh
using the flag -L Syn7002
.
It may be desirable to analyze data obtained from experiments where multiple libraries have been cultivated together. To create a combination library, use the combine_libraries.R
script:
source/combine_libraries.R <new library name> <library 1> <library 2> <...>
Any number of libraries may be combined. The combo
library was created from 7002
, Syn6803
, Syn6803_OE1
, and Utex
in this way. If the same barcodes label multiple genomic fragments, deduplicated (dedup
) and multi-fragment (multi
) barcode files are generated along the regular unique barcode "BPAG" file in the new library:
ls -1 libraries/combo
combo.bpag.tab
combo.dedup.bpag.tab
combo.gff
combo.multi.bpag.tab
When running DubDub on such a library it will take a Dedup detour
to run the fscore.py
script in order to calculate fragment scores along the gene scores. Gene scores can only be calculated based on fragments with unique barcodes, so the fragment scores may be used to investigate further the impact of genes situated on fragments with non-unique barcodes. Fragment scores are stored in a file named fragment_scores.tab
, which includes information about what genes are present on the fragments.
Note that in order to accommodate that Syn6803
and Syn6803_OE1
represent the same organism, it was necessary to make the Syn6803_OE1
GFF file empty, and run the following command after combining the libraries:
perl -p -i -e 's/Syn6803_OE1_/Syn6803_/g' libraries/combo/*
The pipeline automatically removes concatenated fastq.gz
files from the output directory to save space. If concatenated fastq.gz files are desired, run the concatenation script manually:
source/concatenate_fastq.sh example/data example/fastq
Johannes Asplund-Samuelsson ([email protected])