Giter Site home page Giter Site logo

cparty's Introduction

CParty

Description:

Software implementation of CParty.
CParty is an algorithm for computing the conditional partition function for density-2 RNA pseudoknots.

Cite:

Trinity, Luke, Sebastian Will, Yann Ponty, Ulrike Stege, and Hosna Jabbari. "CParty: Conditional partition function for density-2 RNA pseudoknots." bioRxiv (2023): 2023-05. https://doi.org/10.1101/2023.05.16.541023

Supported OS:

Linux macOS

Installation:

Requirements: A compiler that supports C++11 standard (tested with g++ version 4.7.2 or higher) and CMake version 3.1 or greater.

CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:

cmake --version

If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.

Mac:

Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:

/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"   

When that finishes, run the following from a terminal to install CMake.

brew install cmake   

Linux:

Run from a terminal

wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install

Linux instructions source

Steps for installation

  1. Download the repository and extract the files onto your system.
  2. From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build

If you need to specify a specific compiler, such as g++, you can instead run something like

cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build

This can be useful if you are getting errors about your compiler not having C++17 features.

Help

Usage: CParty[options] [input sequence]

Read input file from cmdline; predict minimum free energy, ensemble energy, and optimum structure using the RNA folding algorithm.

  -h, --help             Print help and exit
  -V, --version          Print version and exit
  -r, --input-structure  Give a restricted structure as an input structure
  -i, --input-file       Give a path to an input file containing the sequence (and input structure if known)
  -o, --output-file      Give a path to an output file which will the sequence, and its structure and energy
  -n, --opt              Specify the number of suboptimal structures to output (default is 1)
  -p  --pk-free          Specify whether you only want the pseudoknot-free structure to be calculated
  -k  --pk-only          Only add base pairs which cross the constraint structure. The constraint structure is returned if there are no energetically favorable crossing base pairs
  -d  --dangles          Specify the dangle model to be used (base is 2)
  -P, --paramFile        Read energy parameters from paramfile, instead of using the default parameter set.\n
      --noConv           Do not convert DNA into RNA. This will use the Matthews 2004 parameters for DNA
  

How to use:

Remarks:
    make sure the <arguments> are enclosed in "", for example -r "..(...).." instead of -r ..(...)..
    input file for -i must be .txt
    if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
    if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
    if -o is provided with just a file name without a path, and if -i is provided, then the output file will be generated in the directory where the input file is located
    if suboptimal structures are specified, repeated structures are skipped. That is, if different input structures come to the same conclusion, only those that are different are shown
    If no input structure is given, or suboptimal structures are greater than the number given, CParty generates hotspots to be used as input structures -- where hotspots are energetically favorable stems
    The default parameter file is Turner2004. This can be changed via -P and specifying the parameter file you would like

Sequence requirements:
    containing only characters GCAU

Structure requirements:
    -pseudoknot free
    -containing only characters .x()
    Remarks:
        Restricted structure symbols:
            () restricted base pair
            . no restriction
            x restricted to unpaired


Input file requirements:
        Line1: FASTA name (optional)
        Line2: Sequence
        Line3: Structure
    sample:
        >Sequence1 (optional)
        GCAACGAUGACAUACAUCGCUAGUCGACGC
        (............................)

Example:

Assume you are in the CParty directory
./build/CParty -i "/home/username/Desktop/myinputfile.txt"
./build/CParty -i "/home/username/Desktop/myinputfile.txt" --o "outputfile.txt"
./build/CParty -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -r "(((((.........................)))))................" -d2 GGGGGAAAAAAAGGGGGGGGGGAAAAAAAACCCCCAAAAAACCCCCCCCCC
./build/CParty -p -r "(............................)" -o "/home/username/Desktop/some_folder/outputfile.txt" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -n 3 -r "(............................)" -o "/home/username/Desktop/some_folder/outputfile.txt" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -k -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -P "src/params/parameters_DP09.txt" -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC

SARS-CoV-2 Example

./build/CParty -r "..(((((((((((..........)))))))))))....................................." UUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCU

Questions

For questions, you can email [email protected]

cparty's People

Contributors

hosnajabbari avatar mateog4712 avatar

Watchers

 avatar

Forkers

s-will

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.