itsdavidmandal/dnaanalyser

The provided code is a collection of functions for performing various DNA sequence analyses. It offers several functionalities to analyze DNA sequences, including finding patterns, calculating GC content, identifying motifs, and predicting protein coding regions.

dnaanalyser

The provided code is a collection of functions for performing various DNA sequence analyses. It offers several functionalities to analyze DNA sequences, including finding patterns, calculating GC content, identifying motifs, and predicting protein coding regions.

DNA Sequence Analysis

This code provides several functions for analyzing DNA sequences, including finding patterns, calculating GC content, identifying motifs, and predicting protein coding regions.

Functions

1. find_pattern(sequence, pattern): Finds occurrences of a pattern in a DNA sequence and returns a list of starting indices of the pattern matches.

2. calculate_gc_content(sequence): Calculates the GC content of a DNA sequence and returns the GC content as a percentage.

3. find_motifs(sequence, motifs): Finds motifs (subsequences) in a DNA sequence and returns a list of starting indices of the motif matches.

4. predict_protein_coding_regions(sequence): Predicts protein coding regions in a DNA sequence and returns a list of protein coding regions as tuples of start and end indices.

Breakdown of the output

7. DNA Sequence: ATGGTACCCTAAATGTAGCTAGCTAAAGTCCCATG Pattern Matches: [9, 23] GC Content: 42.857142857142854 Motif Matches: [8, 12, 32, 15, 19] Coding Regions: [(0, 11), (12, 17)]

Process finished with exit code 0

The provided DNA sequence is "ATGGTACCCTAAATGTAGCTAGCTAAAGTCCCATG". Let's break down the results obtained from the code:

1. Pattern Matches: The pattern "TAA" was searched within the DNA sequence, and it was found at indices 9 and 23.

2. GC Content: The GC content of the DNA sequence was calculated to be approximately 42.86%. This value represents the percentage of nucleotides in the sequence that are either Guanine (G) or Cytosine (C).

3. Motif Matches: The motifs "ATG" and "TAG" were searched within the DNA sequence. The motif "ATG" was found at indices 8 and 12, while the motif "TAG" was found at indices 32 and 15. The motif "TAG" was also found at index 19.

4. Coding Regions: The code predicted the protein coding regions in the DNA sequence. It identified two coding regions: one from index 0 to 11 and another from index 12 to 17. These regions are potential locations where protein-coding genes may be present.

The process finished with exit code 0, indicating that the code executed successfully without any errors or issues.

Example Usage

dna_sequence = "ATGGTACCCTAAATGTAGCTAGCTAAAGTCCCATG"
pattern = "TAA"
motifs = ["ATG", "TAG"]
coding_regions = predict_protein_coding_regions(dna_sequence)

print("DNA Sequence:", dna_sequence)
print("Pattern Matches:", find_pattern(dna_sequence, pattern))
print("GC Content:", calculate_gc_content(dna_sequence))
print("Motif Matches:", find_motifs(dna_sequence, motifs))
print("Coding Regions:", coding_regions)