Giter Site home page Giter Site logo

mitefinder's Introduction

miteFinder

################################################################################

AUTHOR: JIALU HU EMAIL: [email protected]

Copyright (C) <2019>

This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.

This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.

You should have received a copy of the GNU General Public License along with this program. If not, see http://www.gnu.org/licenses/.

################################################################################

Description

We have geneated binary code fro Unix-like, Mac, and Windows users (see in $miteFinder/bin) Normally, it will works on machines with x86_64.

If it doesn't work, you need to compile the source code for your own. ################################################################################

Compile

To compile the source code, the latest compilers which supports the standard language C++11, also known as C++0x, is needed. Other older compiler may not support it.

Use the code as the following:

cd $miteFinder

make

Then the binary code "miteFidner" will be generated and moved to $miteFidner/bin. Finished :) ################################################################################

Example

./bin/miteFinder -input ${your_input_file} -output ${your_output_file} -pattern_scoring ./profile/pattern_scoring.txt -threshold 0.5

Warning: Your input file should be in sequences or genomes in fasta format. ################################################################################

Result

The description of the MITE is just like this:

mite|6|4131|4140|4194|4203|t3|4138|m1|ave_score:0.649614 GTTGCTCACCCCTGCTCTTGAGCCTTTGAAACATCTACACCAATTTTTTATTGTTTTCAT CTATCCGTTTAAGTGGATTAAAATGATGTTTTTTAATTTTTTTTTATATTTTTTGGGCCG AAAAAACGGACAGCATTGAAAAAAGCCAAGTTTTATTTAATTTAAGAAAAAATAGTCCAA CCAAATGGTTTAA

The 6 means the serial number of chromosome and 4131,4140,4194,4203 is the position of TIR. t3 means the length of TSD is 3. m1 means the TIR is the imperfect inverted repeats and 4138 is the mismatch base. The ave_score:0.649614 is the score of MITE sequence(The more details can be seen in the below citation). ################################################################################

Citation

Hu, Jialu and Zheng, Yan and Shang, Xuequn, "MiteFinderII: a novel tool to identify miniature inverted-repeat transposable elements hidden in eukaryotic genomes", BMC Medical Genomics, 2018, 11(5), 101.

################################################################################

END

THANKS FOR READING

If you have any questions regarding to the program, please don't hesitate to contact us through email.

mitefinder's People

Contributors

jhu99 avatar nwpuzhengyan avatar wangjingru avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.