lionking0000 / elmseq Goto Github PK
View Code? Open in Web Editor NEWLicense: MIT License
License: MIT License
[What is ELMSeq?] ELM-seq (expression level monitoring by DNA methylation) uses DamID (Escherichia coli DNA adenine methylase as a reporter coupled with methylation-sensitive restriction enzyme digestion and high-throughput sequencing) to enable in vivo quantitative analyses of upstream regulatory sequences. [ELMSeq.py] This program is taking ELMSeq sequencing files and generating DAMRatios to correponding sequences. [How to use] We assumed that the sequencing format is the same as we described in Nature Communication 2017 Paper. # 1. Need to set proper parameter in ELMSeq.py file # User needs to setup output file folder path OUTPUT_FOLDER = "./output" # User needs to setup corresponding fastq file path # Example sequencing data for transcription study (promoter) UNCUT_FASTQ_PATH = "./data/dam_screen_lib_2_12466_CGTGAT.fastq.gz" # No Enzyme treated sample DPNI_FASTQ_PATH = "./data/dam_screen_lib_2_12466_ACATCG.fastq.gz" # DpnI treated sample MBOI_FASTQ_PATH = "./data/dam_screen_lib_2_12466_GCCTAA.fastq.gz" # MboI treated sample # User needs to specify which experiment it is among followings: ( promoter / utr_with_strong_promoter / utr_with_weak_promoter ) EXPERIMENT_TYPE = "promoter" # "promoter", "utr_with_strong_promoter", "utr_with_weak_promoter" # 2. After properly setting the parameters, User can run the program as following command # python ELMSeq.py # 3. This is the typical command line output [ Starting ELMSeq Analysis ] It might take a long time (more than hours) depending on sequencing size [ Read No Enzyme Treated Sequence File ] ./data/dam_screen_lib_2_12466_CGTGAT.fastq.gz [ Read DpnI Treated Sequence File ] ./data/dam_screen_lib_2_12466_ACATCG.fastq.gz [ Read MboI Treated Sequence File ] ./data/dam_screen_lib_2_12466_GCCTAA.fastq.gz [ Calculating DAMRatios ] [ Finishing ELMSeq Analysis ] # 4. In the output folder, you can see DAMRatios for all the sequences [Output File Format] # 1. The first three line is commented. It gives number of processed reads. # 2. The following results show the DAMRatio and corresponding sequence. Results were sorted by DAMRatio. # uncut_all_cnt uncut_match_cnt DpnI_all_cnt DpnI_match_cnt MboI_all_cnt MboI_match_cnt # 2000000 363302 2000000 353958 2000000 350541 # DAMRatio motif uncut_cnt DpnI_cnt MboI_cnt uncut_CPM DpnI_CPM MboI_CPM 1.575207e+02 TTGTTACGGCGTCGTTCTAAAACATTATAATTATCGAT 17 0 155 49.545557 2.825194 445.026402 1.322770e+02 TCGCTTACGTCAAACAGATCTTTAGTATAATTGACCCT 14 0 130 41.287964 2.825194 373.708068 ...
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.