Comments (1)
Hi,
Thank for posting the question.
To load the model from huggingface:
import torch
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True)
model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True)
To calculate the embedding of a dna sequence
dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC"
inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"]
hidden_states = model(inputs)[0] # [1, sequence_length, 768]
# embedding with mean pooling
embedding_mean = torch.mean(hidden_states[0], dim=0)
print(embedding_mean.shape) # expect to be 768
# embedding with max pooling
embedding_max = torch.max(hidden_states[0], dim=0)[0]
print(embedding_max.shape) # expect to be 768
I will also update the model card and README for the instructions.
from dnabert_2.
Related Issues (20)
- .
- environment about torch version HOT 1
- problem stll in environment HOT 6
- hidden_states = model(inputs)[0] # [1, sequence_length, 768]-- Is the second dimension really the sequence length? HOT 1
- Discuss a question about k-mer HOT 1
- When will the code for pre-training model and training BPE tokenizer be available? HOT 1
- Quickstart Does not work and Embedding Dim is not 768 HOT 1
- Pretraining, Pretraining, Pretraining!!! HOT 2
- I always encounter this error during the fine-tuning evaluation phase HOT 1
- Fine-tune for continuous labels HOT 3
- How do I output the attention from the model? HOT 1
- Special token treatment. HOT 1
- splice site predictions
- Unable to Retrieve ' hidden_states ' Despite ' Setting return_dict=True ' and ' output_hidden_states=True ' HOT 3
- Cannot Reproduce DNA-BERT2‘s Result HOT 1
- GUE+ datasets? HOT 2
- Is it neccessary to train a specific BPE tokenizer on own datasets? HOT 1
- Getting embedding of a sequence HOT 2
- CUDA out of memory HOT 6
- About random factor in the embedding/tokenization process HOT 6
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from dnabert_2.