mjafin / splitnreads Goto Github PK
View Code? Open in Web Editor NEWsplitNreads
License: MIT License
splitNreads
License: MIT License
Dear @mjafin,
thank you for the tool, which is very helpful. However, I got stuck while splitting reads containing two or more N
cigars:
18M2443N77M2449N5M TAGGGGCTCCCGCTGCAGCTCTTTCACTTCCACAAGACCAGAAAGAGTCAGGGCTGAACACAGCTTAGATGCTGTCTTCACTTTGCTATTGTTATCTACA
--- becomes: ---
18M4974H TAGGGGCTCCCGCTGCAG
2461H77M2454H CTCTTTCACTTCCACAAGACCAGAAAGAGTCAGGGCTGAACACAGCTTAGATGCTGTCTTCACTTTGCTATTGTTATCTACA
4987H5M CTACA
Obviously, the second sequence is too long which also holds for the quality string. This happens as a result of your code in lines 80 and 82 extracting the sequence/quality substring. In both, change start_pos:start_pos+offset
to start_pos:offset
because offset
already contains the absolute end position.
This is not a problem for splits of reads containing one N
but clearly for reads containing more.
Thank you for your work,
Manuel
Is it possible to add one function to check cigar length == sequence length before samtools calmd, or sometimes it report error
It seems come from this situation: _N_N*
so it will divide into 3 parts. the read sequence of the second part will include the sequence of third part. Need to trim off.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.