Giter Site home page Giter Site logo

splitnreads's People

Contributors

mjafin avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar

splitnreads's Issues

[Bug] Splitting reads into three or more parts

Dear @mjafin,
thank you for the tool, which is very helpful. However, I got stuck while splitting reads containing two or more N cigars:

18M2443N77M2449N5M TAGGGGCTCCCGCTGCAGCTCTTTCACTTCCACAAGACCAGAAAGAGTCAGGGCTGAACACAGCTTAGATGCTGTCTTCACTTTGCTATTGTTATCTACA
--- becomes: ---
18M4974H           TAGGGGCTCCCGCTGCAG
2461H77M2454H                        CTCTTTCACTTCCACAAGACCAGAAAGAGTCAGGGCTGAACACAGCTTAGATGCTGTCTTCACTTTGCTATTGTTATCTACA
4987H5M                                                                                                           CTACA

Obviously, the second sequence is too long which also holds for the quality string. This happens as a result of your code in lines 80 and 82 extracting the sequence/quality substring. In both, change start_pos:start_pos+offset to start_pos:offset because offset already contains the absolute end position.

This is not a problem for splits of reads containing one N but clearly for reads containing more.

Thank you for your work,
Manuel

Need to check cigar

Is it possible to add one function to check cigar length == sequence length before samtools calmd, or sometimes it report error

It seems come from this situation: _N_N*
so it will divide into 3 parts. the read sequence of the second part will include the sequence of third part. Need to trim off.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.