Giter Site home page Giter Site logo

bootcamp_blog's Introduction

Study of ColE1 expression using public data

Finding relevant data in short read archive

We searched NCBI SRA with the following query:

(((("escherichia coli"[Organism]) 
  AND "illumina"[Platform]) 
  AND "transcriptomic"[Source]) 
  AND "rna seq"[Strategy]) 
  AND ("2018"[Publication Date] : "2019"[Publication Date]) 

This contaions 16 datasets. We downloaded RunInfo table from NCBI and removed columns to produce this:

SRR7119574	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119574	lacZ_ind_RPF_r2
SRR7119575	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119575	lacZ_ind_mRNA_r2
SRR7119576	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119576	lacZ_unind_RPF_r2
SRR7119577	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119577	lacZ_unind_mRNA_r2
SRR7119562	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119562	lacZ_ind_RPF_r1
SRR7119563	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119563	lacZ_ind_mRNA_r1
SRR7119572	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119572	lacZ_unind_RPF_r1
SRR7119573	https://sra-download.ncbi.nlm.nih.gov/traces/sra62/SRR/006952/SRR7119573	lacZ_unind_mRNA_r1

Read processing

The reads contain the following adapaters:

-a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG 
-b TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG 
-g AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGA

bootcamp_blog's People

Contributors

nekrut avatar

Watchers

James Cloos avatar  avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.