I am a Cyber Security Enthusiast and Bug Bounty Hunter from India.
- 🔭 I Break Applications.
- 🌱 Exploring Tools and Builds.
- ⚡ In my free time I solve problems.
- 📫 How to reach me:
Name: Ome Mishra
Type: User
Twitter: ome_mishra
Location: India
Blog: https://omemishra.me
PoC Checking script
Web Application recon automation
a code written by me to decode the DNA Cipher (Genetic ) CTF challenge in which it is in the form of GAAACCACATATGATAAAACATAC
A command line interface for accessing google drive
An exploit for SHAREit <= v 4.0.38
in this module you can chat in local network by just entering the ip address and it will generate a code and u have to put that code after that your pc will be connected as a client and server...
Standalone man-in-the-middle attack framework used for phishing login credentials along with session cookies, alowing to bypass 2-factor authentication.
Evilginx2 Phishlets version (0.2.3) Only For Testing/Learning Purposes
Windows Exploits
A pretty sweet vulnerability scanner
Dictionary of attack patterns and primitives for black-box application fault injection and resource discovery.
A tool to dump a git repository from a website
Tools to perform basic search on GitHub.
Tool for advanced mining for content on Github
Open-Source Phishing Toolkit
This repository is primarily maintained by Omar Santos and includes thousands of resources related to ethical hacking / penetration testing, digital forensics and incident response (DFIR), vulnerability research, exploit development, reverse engineering, and more.
Password Breach Hunting and Email OSINT tool, locally or using premium services. Supports chasing down related email
This is where I share code/material shown in my videos
A collection of hacks and one-off scripts
Aircrack, Airodump, Aireplay, MDK3 and Reaver GUI Application for Android
Advanced Honeypot framework.
CTF Beginners Guide!!
Discover Your Attack Surface
A collection of Burpsuite Intruder payloads, BurpBounty payloads, fuzz lists, malicious file uploads and web pentesting methodologies and checklists.
JackIt - Exploit Code for Mousejack
The Swiss Army knife for automated Web Application Testing
A very simple AI-based personal assistant written in Python.
JexBoss: Jboss (and Java Deserialization Vulnerabilities) verify and EXploitation Tool
a javascript change monitoring tool for bugbounties
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.