Giter Site home page Giter Site logo

opengene / defq Goto Github PK

View Code? Open in Web Editor NEW
28.0 12.0 6.0 510 KB

Please switch to https://github.com/OpenGene/defastq

License: MIT License

Makefile 0.23% C++ 25.65% C 68.20% Objective-C 5.91%
fastq demultiplexing split index illumina dual-index sequencing demux

defq's People

Contributors

sfchen avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

defq's Issues

Enhancement Memory Control

When I extract the fq.gz from size 30G data(fq.gz), the memory will be large, was killed by the system.

defq.sh: line 2: 95033 Killed /Bioinfo/tools/defq --in1 Undetermined_S0_R1_001.fastq.gz -s /Task/OUT/index2.sheet -o /Task/OUT/P5index -f _R1.fastq.gz

15024 fastq 20 0 70.4g 70g 1420 S 2368.2 55.7 456:49.89 defq

cannot demultiplex

Hi, I don't understand what is wrong ...

I have a fastq file with the following sequences. (My barcode is under bracket):

@MN00591:192:000H332YK:1:11102:20930:2477 1:N:0:1
GCCCCCAAAATCAGCGAAATGGGCGCCATTGGTGATGACACCAGGCATCAGAATAAATGTTGTCGGCGAGATATTTGTCGGTCCCAGACTTTCGCTGAACGGCCACGGAGATAGGGCTAGGAGTAACCAGAATGGAGAACGC  [ATATCATTAACAGAG]  GGTACGCTCATCAGAATTAACC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

My barcode file contains the barcode :

#filename,#index1,#index2
A11,ATATCATTAACAGAG,  
H10,ATTAATAGTGGTATG,

But the following command keep creating 0 bytes files.

defq -i file.fastq -o demux_out_dir -s index.csv -f .fastq -z 1

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.