Giter Site home page Giter Site logo

framebot's People

Contributors

gunturus avatar wangqion avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar

framebot's Issues

Failure being caused by certain input sequences.

I am getting the following error being caused by certain sequences. When I remove the offending sequence the process continues fine, but I can't understand how the error is being caused as the input is exactly the same size and format as the other sequences. No sequences are put into the 'failed' output file.

My input is ~7000 rbcl gene nucleotide sequences being corrected against ~170 ncbi protein references as follows:

java -jar ~/programs/RDPTools/FrameBot.jar framebot  -N -o test bac_protein.fas rbcl_nucl.fas

Sequence input example (failure causing):

>DTM44_641
CGTTTTTTAAATTGTATGGAAGGTATTAACCGTGCTGCAGCTGCAACAGGTGAAGTTAAAGGTTCTTACTTAAACGTTACTGCAGCGACTATGGAAGAAGTACTTAAACGCTGTGAATATGCAAAAGAAGTCGGTTCTATTATTGTTATGATCGATTTAGTTATGGGTTATACAGCAATTCAAAGTGCTGCAATCTGGGCTCGTGACAACGATATGCTTTTACATTTACACCGTGCCGGTAACTCTACTTATGCACGTCAAAAAAGTCATGGTATTAATTTCCGTGTAATCTGTAAATGGATGCGTATGTCTGGTGTTGATCATATTCACGCTGGTACAGTTGTAGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTATGATACTTTACGTTTAACAAAATTTAGAGGTTAATTTACCTTATGGTATTTTTCTTCGAAAGTGACATGGGCAAGTTTACGCCGTTGTATGCCTGTTGCATCTGGTGGTATTCATTGTGGTCAAATGCATCAATTAGTTCACTATTTAGGTGATGATGTAATAT

Error Message:

Exception in thread "main" java.lang.IllegalArgumentException: Cannot score R, ?
        at edu.msu.cme.rdp.alignment.pairwise.ScoringMatrix.score(ScoringMatrix.java:180)
        at edu.msu.cme.rdp.framebot.core.FramebotCore.computeMatrix(FramebotCore.java:81)
        at edu.msu.cme.rdp.framebot.core.FramebotCore.processSequence(FramebotCore.java:67)
        at edu.msu.cme.rdp.framebot.cli.FramebotMain.framebotItUp_prefilter(FramebotMain.java:136)
        at edu.msu.cme.rdp.framebot.cli.FramebotMain.main(FramebotMain.java:381)
        at edu.msu.cme.rdp.framebot.cli.Main.main(Main.java:48)

cannot use protein as the reference

Hello. As I have a series of sequences to process, I try to use local FrameBot. Unfortunately, I cannot use protein as the reference, which can be sued on the web FrameBot. But the index works.
So I use the dataset in the RDP pipeline. It has the same problem. So how can I deal with it? Thank you.

Error Message:
java -jar /home/server/RDPTools/FrameBot.jar framebot -o amoaaob_test amoA_prot_ref.fasta /home/server/RDPTools/Xander_assembler/gene_resource/amoA_AOB/originaldata/nucl.fa Exception in thread "main" java.util.zip.ZipException: Not in GZIP format at java.util.zip.GZIPInputStream.readHeader(GZIPInputStream.java:164) at java.util.zip.GZIPInputStream.(GZIPInputStream.java:78) at java.util.zip.GZIPInputStream.(GZIPInputStream.java:90) at edu.msu.cme.rdp.framebot.index.FramebotIndex.readExternalIndex(FramebotIndex.java:186) at edu.msu.cme.rdp.framebot.cli.FramebotMain.main(FramebotMain.java:474) at edu.msu.cme.rdp.framebot.cli.Main.main(Main.java:50)

Problem in installation

I cloned the repository and tried to build the program using ant. However it gives such errors:

-do-compile:
[javac] Compiling 26 source files to /Users/menolinsharma/Framebot/build/classes
[javac] warning: [options] bootstrap class path not set in conjunction with -source 5
[javac] error: Source option 5 is no longer supported. Use 7 or later.
[javac] error: Target option 5 is no longer supported. Use 7 or later.

How do I install/build this program? I am not able to find a good source of instructions for building it given that I have only basic experience in command line. Thank you!

Question about FrameBot index

Hello,

I try to use FrameBot1.0 and i have a problem with index.
When i use framebot with index on example data all sequences are failed. When i do not use index many sequences are corrected.

Test with index

Commands :
java -jar /usr/local/bioinfo/src/FrameBot/current/dist/FrameBot.jar index /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_refseq_prot.fa nifH_test.index
java -jar /usr/local/bioinfo/src/FrameBot/current/dist/FrameBot.jar framebot -o nifH_test nifH_test.index /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_query.fa

Results :
-rw-r--r-- 1 owner GROUP 0 25 janv. 09:48 nifH_test_corr_nucl.fasta
-rw-r--r-- 1 owner GROUP 0 25 janv. 09:48 nifH_test_corr_prot.fasta
-rw-r--r-- 1 owner GROUP 56912 25 janv. 09:48 nifH_test_failed_framebot.txt
-rw-r--r-- 1 owner GROUP 17460 25 janv. 09:48 nifH_test_failed_nucl.fasta
-rw-r--r-- 1 owner GROUP 0 25 janv. 09:48 nifH_test_framebot.txt
-rw-r--r-- 1 owner GROUP 4149 25 janv. 09:46 nifH_test.index

Test without index

Command :
java -jar /usr/local/bioinfo/src/FrameBot/current/dist/FrameBot.jar framebot -N -o nifH_test_withoutIndex /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_refseq_prot.fa /usr/local/bioinfo/src/FrameBot/current/example/nifH_test_query.fa

Results :
-rw-r--r-- 1 owner GROUP 16549 25 janv. 09:50 nifH_test_withoutIndex_corr_nucl.fasta
-rw-r--r-- 1 owner GROUP 6137 25 janv. 09:50 nifH_test_withoutIndex_corr_prot.fasta
-rw-r--r-- 1 owner GROUP 1156 25 janv. 09:50 nifH_test_withoutIndex_failed_framebot.txt
-rw-r--r-- 1 owner GROUP 359 25 janv. 09:50 nifH_test_withoutIndex_failed_nucl.fasta
-rw-r--r-- 1 owner GROUP 56090 25 janv. 09:50 nifH_test_withoutIndex_framebot.txt

Can you explain me this difference ?

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.