Giter Site home page Giter Site logo

cfdscore's Introduction

CFDscoRe

This is an implementation of the CFD score from Doench et al 2016. There is no reference implementation of the CFD score calculation, and the available implementations are either incomplete (focusing only on the mismatch penalties) or are known to contain a bug in the calculation of DNA-bulge containing alignments.

Installation

From R run:

devtools::install_github('shenkers/CFDscoRe')

To do this the R package devtools must be installed.

Usage

For a given guide/target-site alignment, e.g.:

 guide: CA-TGCCGTGTGTACCATGAC
          *    *          * *
target: CAGTGCCATGTGTACCATCAGNGG

The CFD score of the alignment can be calculated by calling:

CFDscoRe::cfd_score('CA-TGCCGTGTGTACCATGAC', 'CAGTGCCATGTGTACCATCAG', 'GG')

This package also provides a function to search for the optimal alignment of a guide to a candidate sequence:

CFDscoRe::optimal_alignment('CATGCCGTGTGTACCATGAC', 'CAGTGCCATGTGTACCATCAGGG')

cfdscore's People

Contributors

shenkers avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.