Giter Site home page Giter Site logo

shenwei356 / bio Goto Github PK

View Code? Open in Web Editor NEW
88.0 7.0 9.0 1.89 MB

A lightweight and high-performance bioinformatics package in Golang

License: MIT License

Go 93.26% R 4.09% Shell 1.00% Perl 1.65% HLSL 0.01%
bioinformatics golang sequence package syncmer scaled-minhash taxonomy taxdump minimizer

bio's Introduction

Wei Shen 沈 伟

Bioinformatician
Institute for Viral Hepatitis, The Second Affiliated Hospital of Chongqing Medical University, China

Github | Twitter | Biostars | Google Scholar | ORCID

  • 🔬 I’m currently working on microbial genomics and metagenomics.
  • 🔭 I'm passionate about reproducible research and open-source software.

Learn more: http://shenwei.me

I'm grateful to users who have greatly helped to report bugs and suggest new features.
I may respond to issues or fix bugs quickly, but I usually implement new features periodically (two or more weeks).

bio's People

Contributors

bsipos avatar ctava avatar elliotwutingfeng avatar mdawell avatar shenwei356 avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar

bio's Issues

GuessQualityEncoding Panic issue.

Hello I'm running into an issue while creating a fastq validator using your fastx package. I've narrowed it down to my call to GuessQualityEncoding

panic: runtime error: index out of range

goroutine 1 [running]:
github.com/shenwei356/bio/seq.GuessQualityEncoding(0xc4207536d0, 0x4a, 0x4a, 0xc4205e0140, 0xc4205d0fc0, 0x31)
	/Users/srynobio1/go/src/github.com/shenwei356/bio/seq/qual.go:225 +0x308
main.main()
	/Users/srynobio1/Projects/goFqValidator/goFqValidator.go:61 +0x427
exit status 2

bio/seq/qual.go

Line 225 in 61346d8

if countSorted[i].Key == 'B' {

And here's the fastq record that the error occurs:

@HWI-ST0831_0238:5:1109:13365:88075#CTTGTACTTGTA/2
GGGGGCAGAACGGCCGACCGCCACCACAAGACATCCTGGGGGACAGAGGCCCTGGGCACAGCCCAGTCCCCATC
+
CCFFDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDCCD

Unable to parse protein fasta file.

I'm guessing your original design was focused on DNA sequence. Do you plan on supporting amino acid encoded fasta files?

panic: error when parsing seq: NP_000572.2 (seq: invalid Protein letter: U)

goroutine 1 [running]:
main.digestFasta(0x7ffeefbffb17, 0x2b, 0x18)
	/Users/srynobio1/go/src/github.com/srynobio/vmccl/vmccl.go:80 +0x38c
main.main()
	/Users/srynobio1/go/src/github.com/srynobio/vmccl/vmccl.go:28 +0x531

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.