smsaladi/codonpair

A codon pair score/codon pair bias calculator

codonpair

codonpair calculates codon pair score and codon pair bias. CPS values are identical to those produced by the perl script from Dimitris Papamichail (cps_perl directory) and, presumably, used in the following work:

Virus attenuation by genome-scale changes in codon pair bias.
Coleman JR1, Papamichail D, Skiena S, Futcher B, Wimmer E, Mueller S.
Science. 2008 Jun 27;320(5884):1784-7. doi: 10.1126/science.1155761.
https://www.ncbi.nlm.nih.gov/pubmed/18583614

Installation

Either, clone the repo and install with pip

git clone [email protected]:smsaladi/codonpair.git
pip install ./codonpair

Or... have pip handle the details:

pip install git+git://github.com/smsaladi/codonpair@master#codonpair

All dependencies should be checked for and, if necessary, installed automatically by pip.

Usage

Initialize a codonpair.CodonPair object by specifying a list of reference sequences CodonPair.from_sequences, from a named reference CodonPair.from_named_reference, a reference file CodonPair.from_reference_file, or simply providing a pd.DataFrame with codon counts to CodonPair.

The following named references are recognized/bundled with this package.

• E. coli (BL21 DE3)
• S. pneumoniae (TIGR4)
• cps_perl - the reference file provided with the perl implementation

The default constructor CodonPair() uses the E. coli.

Then calculate the codon pair score for a provided sequence with CodonPair.cpb which returns a dictionary with the

• total codon pair score total_cps - the sum of the values of each codon pair
• the number of codons n_pair - excluding codon pairs not found in the reference
• the codon pair bias cpb - total_cps/n_pair

For one-off calculations, codonpair.calc_cpb can be used directly for with the sequence of interest (calling the default constructor under the hood).

import codonpair
cp = codonpair.CodonPair.from_named_reference('E. coli')
cp.cpb("ATGATCCCCTTACAACATGGACTGATCCTCGCGGCAATCTTATTCGTTCTTGGCTTAACC")

For convenience, the executable cps installed into the path by pip:

cps test.fasta > test.scores.txt

See CodonPair.write_reference to write codon pair counts for a reference set to the filename provided to be used with future calculations.

codonpair's Issues

codonpair package on pypi doesn't include data files

Hi,

I'm trying codonpair python package. First, I installed it from pypi via pip, I got following error.

FileNotFoundError: [Errno 2] File /usr/local/var/pyenv/versions/3.7.4/lib/python3.7/site-packages/codonpair/data/ec_de3_ref.cps.tbd does not exist: '/usr/local/var/pyenv/versions/3.7.4/lib/python3.7/site-packages/codonpair/data/ec_de3_ref.cps.tbd'

Because codonpair-0.1.1.tar.gz does not contains data directory, it does not install reference data.

x drwxrwxr-x  0 travis travis      0  2 21  2020 codonpair-0.1.1/
x drwxrwxr-x  0 travis travis      0  2 21  2020 codonpair-0.1.1/codonpair.egg-info/
x -rw-rw-r--  0 travis travis   3636  2 21  2020 codonpair-0.1.1/codonpair.egg-info/PKG-INFO
x -rw-rw-r--  0 travis travis      1  2 21  2020 codonpair-0.1.1/codonpair.egg-info/zip-safe
x -rw-rw-r--  0 travis travis      1  2 21  2020 codonpair-0.1.1/codonpair.egg-info/dependency_links.txt
x -rw-rw-r--  0 travis travis     10  2 21  2020 codonpair-0.1.1/codonpair.egg-info/top_level.txt
x -rw-rw-r--  0 travis travis    315  2 21  2020 codonpair-0.1.1/codonpair.egg-info/SOURCES.txt
x -rw-rw-r--  0 travis travis     23  2 21  2020 codonpair-0.1.1/codonpair.egg-info/requires.txt
x -rw-rw-r--  0 travis travis     50  2 21  2020 codonpair-0.1.1/codonpair.egg-info/entry_points.txt
x -rw-rw-r--  0 travis travis   3636  2 21  2020 codonpair-0.1.1/PKG-INFO
x -rw-rw-r--  0 travis travis   2709  2 21  2020 codonpair-0.1.1/README.md
x -rw-rw-r--  0 travis travis     38  2 21  2020 codonpair-0.1.1/setup.cfg
x drwxrwxr-x  0 travis travis      0  2 21  2020 codonpair-0.1.1/test/
x -rw-rw-r--  0 travis travis   2452  2 21  2020 codonpair-0.1.1/test/test_regression.py
x -rw-rw-r--  0 travis travis    917  2 21  2020 codonpair-0.1.1/setup.py
x drwxrwxr-x  0 travis travis      0  2 21  2020 codonpair-0.1.1/codonpair/
x -rw-rw-r--  0 travis travis   9420  2 21  2020 codonpair-0.1.1/codonpair/codonpair.py
x -rw-rw-r--  0 travis travis     66  2 21  2020 codonpair-0.1.1/codonpair/__init__.py

I've checkout the repo and build the package with python setup.py bdist_wheel and python setup.py sdist command. These command generated codonpair-0.1.1-py3-none-any.whl and codonpair-0.1.1.tar.gz contains data dir as expected. So setup.py does not have issues.

Could you please re-build a distribution contains data dir and publish it to pypi ?