adding variation with map / mod does not seem to work

[glennhickey]

adding variation with map / mod does not seem to work

[ekg]

It looks like path naming is partly broken. I think your post includes everything I'll need to test.

[ekg]

First I set things up in the same way:

➜  test git:(master) ✗ vg construct -r tiny/tiny.fa >t.vg                                                                     
➜  test git:(master) ✗ vg index -s -k 11 t.vg            

It looks like the problem is that introducing the SNP into the first few bases of the read doesn't result in an alignment that detects the SNP. Note that the first edit in the mapping has "to_length" : 2. "from_length" : 0 is implied. This is equivalent to an insertion, but when we have it at the start or end of the alignment it means "soft clip".

➜  test git:(master) ✗ vg map -s CGAATAAGGCTTGGAAATTTTCTGGAGTTCTATTATATTCCAACTCTCTT -Q new t.vg | vg view -a - | jq .
{
  "sequence": "CGAATAAGGCTTGGAAATTTTCTGGAGTTCTATTATATTCCAACTCTCTT",
  "path": {
    "mapping": [
      {
        "position": {
          "offset": 2,
          "node_id": 1
        },
        "edit": [
          {
            "to_length": 2
          },
          {
            "from_length": 47,
            "to_length": 47
          },
          {
            "to_length": 1
          }
        ]
      }
    ]
  },
  "name": "new",
  "score": 94
}

So there isn't any variation reported by the alignment. This is typical and actually a big part of why single reference-based alignment has problems for stuff like allele specific expression.

Inclusion will work provided we can align through the variant. So, I insert a SNP later on in the read.

➜  test git:(master) ✗ vg construct -r tiny/tiny.fa >t.vg                                                                     
➜  test git:(master) ✗ vg index -s -k 11 t.vg            
➜  test git:(master) ✗ vg map -s CAAATAAGGCTTGGAAATGTTCTGGAGTTCTATTATATTCCAACTCTCTT -Q new t.vg | vg mod -i - t.vg | vg view -
H       HVN:Z:1.0
S       2       CAAATAAGGCTTGGAAAT
P       2       x       +       18M
L       2       -       4       +       0M
L       2       -       6       +       0M
S       4       T
P       4       x       +       1M
L       4       -       5       +       0M
S       5       TTCTGGAGTTCTATTATATTCCAACTCTCTG
P       5       x       +       31M
S       6       G
P       6       new     +       1M
L       6       -       5       +       0M