alan-collins/crispr_comparison_toolkit

Tools to analyze the differences and similarities between CRISPR arrays

crispr_comparison_toolkit's Issues

Please, add your repeat sequence.

We discovered that the CRISPR subtype repeats from the P.inopinatus are not included in your default database.

Here, CRISPR repeat sequence information (direction is confirmed).

GTTTTAGAAGAGTGTCGAATCAATATAGTTAAGATC

Also, some of the repeat mutant sequence (Marked with bold)

GTTTTAGAAGAGTGTCGAATCAATATAGTTAATGAG

GTTTTAGAAGAGTGTCGAATCAATATAGTTAAAATC

ACCTTCAAAGAGTGTCGAATCAATATAGTTAAGATC

GTTCTAGAAGAGTGTCGAATCAATATAGTTAAGATC

I also attached a figure to illustrate the sequence difference above.

If you add my subtypes to the database it will be helpful for the analysis.

Best regards,
Wooje

blast and spacerblast

Hi Alan,

First of all, thanks for such nice pipeline! I tried the blast and spacerblast and I got 2 different issues (that seem to be associated with blast but this is my guess). I installed cctk with conda. I tried with blastn: 2.12.0+ and the initial version installed with conda (blastn: 1.5.0).

For cctk blast, the program ran but no outputs are generated. Not sure what is happening...

For spacerblast, I used the following command (I modified the unique header to remove the special char and then use makeblastdb).
cctk spacerblast -d genomad_out_Champ/virus_db -s Spacers_nored.fna -o spacer_virus.txt -t 8
ERROR running blastdbcmd on genomad_out_Champ/virus_db :
k141_19678925 2983-3018 plus k141_14048783 1561-1596 plus k141_15935713 689-724 plus k141_27198690 4927-4962 plus k141_97260130 16071-16106 plus k141_25286444 6929-6964 plus k141_4415261 854-889 plus k141_49836241 985-1020 plus k141_85792883 2823-2858 plus k141_17594327 2761-2796 plus k141_83872733 4683-4718 plus k141_21295442 1117-1152 ...
Then nothing happened....

If you have any idea, would be awesome!

Cheers,

Nico