Giter Site home page Giter Site logo

andreaferretti / cello Goto Github PK

View Code? Open in Web Editor NEW
76.0 19.0 10.0 236 KB

A string library

Home Page: https://andreaferretti.github.io/cello/

License: Apache License 2.0

Nim 100.00%
wavelet-tree strings string-search succinct fm-index burrows-wheeler-transform suffix-array

cello's Issues

License Problem

One of Nim's top advocacy points is the degree to which it and its module ecosystem is copyfree - anyone can use it for whatever purpose without becoming subjected to pages and pages of legal threats that no one really understands...

Nim uses the MIT license for all of its compiler, stdlib, and tooling - and that is also what nimble recommends as the default for new modules. Over 87% of nimble modules currently fit the copyfree standard, higher than any other programming language that Nim competes with.

Your module currently uses the Apache License, which is not considered free by copyfree.org:

  • Section 4, subsections 2 and 4 of the Apache License 2.0 violate point 3 (Free Modification and Derivation) of the Copyfree Standard Definition by specifying conditions (beyond licensing) that must apply to modifications.

People who care about genuine software freedom are looking to Nim for many long-term project ideas (ex. BSD Unix with Nim userland), but we will exclude any components that aren't copyfree (or have dependencies that aren't copyfree).

What are your reasons for using the AL2? Why not use a copyfree license like MIT instead?

IndexDefect when using searchIndex.search

Hi @andreaferretti! I'm trying to use this awesome library for some bioinformatics but am running into a strange error:

import cello

let x = "CGGGACTTACTTGTGGTTCCTGTGGTGCACTCCTGACCCTGCCGCTTTGAAAGAAAAAGAAATGAGGCGAAGAAGTCCTTCAGGGATCCCCGGGGAAACCTGGAGGAAGTCCGACGAGATCGCGGCTGGGGCTTAGGACCCCACTCCTGCGAGACAGGAGTAATCCTAAACAGGGTTTTCACCCTTCCTTTAGTTTCCTTCCTCTCCTGGAGAGGTCTTCTGCCCTAGCCCGGTCTTCGAAGCTTCCTTTGGCTACTACCCGGTGGAAACAACTGAAGCTTCAACGCCTTTTTTTCCAATCTTCTTTAGCACCGGGCTAGGGAGTAAGCCCGTGGAACCTTAGTTTTGTTCCCT"

# works
let index2 = searchIndex(x[0..x.high-1])
echo index2.search(x[0..1])


# breaks
let index1 = searchIndex(x)
echo index1.search(x[0..1])

This specific sequence is unable to be searched, although removing the last character does allow it to be search. Do you have any idea why that could be?

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.