andreaferretti/cello

A string library

cello's Issues

License Problem

One of Nim's top advocacy points is the degree to which it and its module ecosystem is copyfree - anyone can use it for whatever purpose without becoming subjected to pages and pages of legal threats that no one really understands...

Nim uses the MIT license for all of its compiler, stdlib, and tooling - and that is also what nimble recommends as the default for new modules. Over 87% of nimble modules currently fit the copyfree standard, higher than any other programming language that Nim competes with.

Your module currently uses the Apache License, which is not considered free by copyfree.org:

• Section 4, subsections 2 and 4 of the Apache License 2.0 violate point 3 (Free Modification and Derivation) of the Copyfree Standard Definition by specifying conditions (beyond licensing) that must apply to modifications.

People who care about genuine software freedom are looking to Nim for many long-term project ideas (ex. BSD Unix with Nim userland), but we will exclude any components that aren't copyfree (or have dependencies that aren't copyfree).

What are your reasons for using the AL2? Why not use a copyfree license like MIT instead?

IndexDefect when using searchIndex.search

Hi @andreaferretti! I'm trying to use this awesome library for some bioinformatics but am running into a strange error:

import cello

let x = "CGGGACTTACTTGTGGTTCCTGTGGTGCACTCCTGACCCTGCCGCTTTGAAAGAAAAAGAAATGAGGCGAAGAAGTCCTTCAGGGATCCCCGGGGAAACCTGGAGGAAGTCCGACGAGATCGCGGCTGGGGCTTAGGACCCCACTCCTGCGAGACAGGAGTAATCCTAAACAGGGTTTTCACCCTTCCTTTAGTTTCCTTCCTCTCCTGGAGAGGTCTTCTGCCCTAGCCCGGTCTTCGAAGCTTCCTTTGGCTACTACCCGGTGGAAACAACTGAAGCTTCAACGCCTTTTTTTCCAATCTTCTTTAGCACCGGGCTAGGGAGTAAGCCCGTGGAACCTTAGTTTTGTTCCCT"

# works
let index2 = searchIndex(x[0..x.high-1])
echo index2.search(x[0..1])


# breaks
let index1 = searchIndex(x)
echo index1.search(x[0..1])

This specific sequence is unable to be searched, although removing the last character does allow it to be search. Do you have any idea why that could be?

Check out other algorithms for Suffix Array

• https://github.com/y-256/libdivsufsort/blob/wiki/SACA_Benchmarks.md
• https://arxiv.org/abs/1307.1417