bachev/mira

MIRA sequence assembler

mira's Issues

How perform hybrid assembly with illumina and sanger reads?

Hi @bachev
I want to get the sequence of a plasmid in a project that has paired end illumina reads and sanger reads (ab1 files that I convert to scf files as recommended by the manual). The problem is that I don't config correcly the manifest file to use the scf files. Can you give me a manifest example of paired illumina reads combined with scf files for hybrid assembly?

Thank you in advance

Pedro Seoane

Are binaries available?

Are there any Darwin binaries available? Thanks.

Apologies, didn't mean to post here

the entry for the strand (0) is not 0, 1, 2, 3 or .

Hello.
I was trying to assemble a genome with mira, and the process got killed for some reason (probably the server ran out of memory). When I tried to resume the assembly from a checkpoint by using -r option mira stopped and printed this message:

This is MIRA V5rc2_0+gae5beb0.

Please cite: Chevreux, B., Wetter, T. and Suhai, S. (1999), Genome Sequence
Assembly Using Trace Signals and Additional Sequence Information.
Computer Science and Biology: Proceedings of the German Conference on
Bioinformatics (GCB) 99, pp. 45-56.

To (un-)subscribe the MIRA mailing lists, see:
	http://www.chevreux.org/mira_mailinglists.html

After subscribing, mail general questions to the MIRA talk mailing list:
	[email protected]


To report issues or ask for features, please use the GitHub issue
system at:
	https://github.com/bachev/mira/issues
This ensures that requests do not get lost.


Compiled by: root
Пн янв 27 12:26:43 +08 2020
On: Linux alexander-PC 5.3.0-26-generic #28-Ubuntu SMP Wed Dec 18 05:37:46 UTC 2019 x86_64 x86_64 x86_64 GNU/Linux
Compiled in boundtracking mode.
Compiled in bugtracking mode.
Compiled with ENABLE64 activated.
Runtime settings (sorry, for debug):
	Size of size_t  : 8
	Size of uint32  : 4
	Size of uint32_t: 4
	Size of uint64  : 8
	Size of uint64_t: 8
Current system: Linux alexander-PC 5.3.0-26-generic #28-Ubuntu SMP Wed Dec 18 05:37:46 UTC 2019 x86_64 x86_64 x86_64 GNU/Linux

Manifest:
projectname: B35_denovo_mira
job: genome,denovo,accurate
parameters: -NW:cmrnl=no
Manifest load entries: 1
MLE 1:
RGID: 1
RGN: B35	SN: StrainX
SP: 	SPio: 0	SPC: 0	IF: -1	IT: -1	TSio: 0
ST: 6 (Solexa)	namschem: 4	SID: 0
DQ: 30
BB: 0	Rail: 0	CER: 0

/home/alexander/Annelids/B35/35_S3_R1_001.fastq 
********************************************************************************
* Binary: /usr/local/bin/mira                                                  *
********************************************************************************
Parameters parsed without error, perfect.
Overriding number of threads via '-t' with 64

-CL:pec and -CO:emeas1clpec are set, setting -CO:emea values to 1.
------------------------------------------------------------------------------
Parameter settings seen for:
Sanger data

Used parameter settings:
  General (-GE):
	Project name                                : B35_denovo_mira
	Number of threads (not)                     : 64
	Automatic memory management (amm)           : yes
	    Keep percent memory free (kpmf)         : 15
	    Max. process size (mps)                 : 0
	EST SNP pipeline step (esps)                : 0
	Colour reads by kmer frequency (crkf)       : yes
	Preprocess only (ppo)                       : no

  Load reads options (-LR):
	Wants quality file (wqf)                    :  [sxa]  yes

	Filecheck only (fo)                         : no

  Assembly options (-AS):
	Use genomic pathfinder (ugpf)               : yes

	Number of passes (nop)                      : 0
	Kmer series (kms)                           : 
	Maximum number of RMB break loops (rbl)     : 2
	Maximum contigs per pass (mcpp)             : 0

	Minimum read length (mrl)                   :  [sxa]  20
	Minimum reads per contig (mrpc)             :  [sxa]  10
	Enforce presence of qualities (epoq)        :  [sxa]  yes

	Automatic repeat detection (ard)            : yes
	    Coverage threshold (ardct)              :  [sxa]  2.5
	    Minimum length (ardml)                  :  [sxa]  300
	    Grace length (ardgl)                    :  [sxa]  20
	    Use uniform read distribution (urd)     : no
	      Start in pass (urdsip)                : 3
	      Cutoff multiplier (urdcm)             :  [sxa]  1.5

	Spoiler detection (sd)                      : yes
	    Last pass only (sdlpo)                  : yes

	Use emergency search stop (uess)            : yes
	    ESS partner depth (esspd)               : 500
	Use emergency blacklist (uebl)              : yes
	Use max. contig build time (umcbt)          : no
	    Build time in seconds (bts)             : 10000

  Strain and backbone options (-SB):
	Bootstrap new backbone (bnb)                :  [sxa]  yes
	Start backbone usage in pass (sbuip)        : 0
	Backbone rail from strain (brfs)            : 
	Backbone rail length (brl)                  : 0
	Backbone rail overlap (bro)                 : 0
	Trim overhanging reads (tor)                : yes

  Dataprocessing options (-DP):
	Use read extensions (ure)                   :  [sxa]  no
	    Read extension window length (rewl)     :  [sxa]  30
	    Read extension w. maxerrors (rewme)     :  [sxa]  2
	    First extension in pass (feip)          :  [sxa]  0
	    Last extension in pass (leip)           :  [sxa]  0

  Clipping options (-CL):
	SSAHA2 or SMALT clipping:
	    Gap size (msvsgs)                       :  [sxa]  1
	    Max front gap (msvsmfg)                 :  [sxa]  2
	    Max end gap (msvsmeg)                   :  [sxa]  2
	    Strict front clip (msvssfc)             :  [sxa]  0
	    Strict end clip (msvssec)               :  [sxa]  0
	Possible vector leftover clip (pvlc)        :  [sxa]  no
	    maximum len allowed (pvcmla)            :  [sxa]  18
	Min qual. threshold for entire read (mqtfer):  [sxa]  5
	    Number of bases (mqtfernob)             :  [sxa]  15
	Quality clip (qc)                           :  [sxa]  no
	    Minimum quality (qcmq)                  :  [sxa]  20
	    Window length (qcwl)                    :  [sxa]  30
	Bad stretch quality clip (bsqc)             :  [sxa]  no
	    Minimum quality (bsqcmq)                :  [sxa]  5
	    Window length (bsqcwl)                  :  [sxa]  20
	Masked bases clip (mbc)                     :  [sxa]  no
	    Gap size (mbcgs)                        :  [sxa]  5
	    Max front gap (mbcmfg)                  :  [sxa]  12
	    Max end gap (mbcmeg)                    :  [sxa]  12
	Lower case clip front (lccf)                :  [sxa]  no
	Lower case clip back (lccb)                 :  [sxa]  no
	Clip poly A/T at ends (cpat)                :  [sxa]  no
	    Keep poly-a signal (cpkps)              :  [sxa]  no
	    Minimum signal length (cpmsl)           :  [sxa]  12
	    Max errors allowed (cpmea)              :  [sxa]  1
	    Max gap from ends (cpmgfe)              :  [sxa]  9
	Clip 3 prime polybase (c3pp)                :  [sxa]  yes
	    Minimum signal length (c3ppmsl)         :  [sxa]  15
	    Max errors allowed (c3ppmea)            :  [sxa]  3
	    Max gap from ends (c3ppmgfe)            :  [sxa]  9
	Clip known adaptors right (ckar)            :  [sxa]  yes
	Ensure minimum left clip (emlc)             :  [sxa]  no
	    Minimum left clip req. (mlcr)           :  [sxa]  0
	    Set minimum left clip to (smlc)         :  [sxa]  0
	Ensure minimum right clip (emrc)            :  [sxa]  no
	    Minimum right clip req. (mrcr)          :  [sxa]  10
	    Set minimum right clip to (smrc)        :  [sxa]  20

	GB chimera detection clip (gbcdc)           : yes
	KMER junk detection (kjd)                   : yes
	    KMER junk complete kill (kjck)          : no
	DEPRECATED! Apply SKIM chimera detection clip (ascdc): yes
	DEPRECATED! Apply SKIM junk detection clip (asjdc): no

	Propose end clips (pec)                     :  [sxa]  yes
	    Kmer size (peckms)                      : 31
	    Minimum kmer for forward-rev (pmkfr)    : 1
	    Minimum total kmer (pmtk)               : 3
	    Handle Solexa GGCxG problem (pechsgp)   : yes
	    Continuous (pecc)                       : yes

	Rare kmer mask (rkm)                        :  [sxa]  no
	    Front freq (pffreq)                     :  [sxa]  0
	    Back freq (pbfreq)                      :  [sxa]  0
	    Front forward-rev (pffore)              :  [sxa]  yes
	    Back forward-rev (pbfore)               :  [sxa]  yes
	    Front conf. multi-seq type (pfcmst)     :  [sxa]  yes
	    Back conf. multi-seq type (pbcmst)      :  [sxa]  yes
	    Front seen at low pos (pfsalp)          :  [sxa]  no
	    Back seen at low pos (pbsalp)           :  [sxa]  no

	Clip bad solexa ends (cbse)                 :  [sxa]  yes
	Search PhiX174 (spx174)                     :  [sxa]  yes
	    Filter PhiX174 (fpx174)                 :  [sxa]  no

	Filter rRNA (frrna)                         : no
	    Pairs (frrnap)                          : no
	    Number of kmers (frrnank)               : 17

  Parameters for SKIM algorithm (-SK):
	Number of threads (not)                     : 64

	Also compute reverse complements (acrc)     : yes
	Kmer size (kms)                             : 17
	    Automatic increase per pass (kmsaipp)   : 0
	    Kmer size max(kmsmax)                   : 0
	Kmer save stepping (kss)                    : 1
	Percent required (pr)                       :  [sxa]  95

	Max hits per read (mhpr)                    : 2000

	Filter megahubs (fmh)                       : yes
	    Megahub cap (mhc)                       : 150000
	    Max megahub ratio (mmhr)                : 0

	SW check on backbones (swcob)               : no

	Max kmers in memory (mkim)                  : 15000000
	MemCap: hit reduction (mchr)                : 4096

  Parameters for Kmer Statistics (-KS):
	Freq. cov. estim. min (fcem)                : 0
	Freq. estim. min normal (fenn)              : 0.4
	Freq. estim. max normal (fexn)              : 1.6
	Freq. estim. repeat (fer)                   : 1.9
	Freq. estim. heavy repeat (fehr)            : 8
	Freq. estim. crazy (fecr)                   : 20
	Mask nasty repeats (mnr)                    : yes
	    Nasty repeat ratio (nrr)                : 100
	    Nasty repeat coverage (nrc)             : 0
	    Lossless digital normalisation (ldn)    : no

	Repeat level in info file (rliif)           : 6

	Memory to use (mtu)                         : 75
	Rare kmer final kill (rkfk)                 : 0

  Pathfinder options (-PF):
	Use quick rule (uqr)                        :  [sxa]  yes
	    Quick rule min len 1 (qrml1)            :  [sxa]  -95
	    Quick rule min sim 1 (qrms1)            :  [sxa]  100
	    Quick rule min len 2 (qrml2)            :  [sxa]  -85
	    Quick rule min sim 2 (qrms2)            :  [sxa]  100
	Backbone quick overlap min len (bqoml)      :  [sxa]  20
	Max. start cache fill time (mscft)          : 5

  Align parameters for Smith-Waterman align (-AL):
	Bandwidth in percent (bip)             :  [sxa]  20
	Bandwidth max (bmax)                   :  [sxa]  80
	Bandwidth min (bmin)                   :  [sxa]  20
	Minimum score (ms)                     :  [sxa]  15
	Minimum overlap (mo)                   :  [sxa]  17
	Minimum relative score in % (mrs)      :  [sxa]  90

	Enforce clean ends (ece)               : no
	    Clean end distance (ced)           : 0
	    Clean end mismatch allowed (cema)  : 0
	Extra gap penalty (egp)                : yes
	    extra gap penalty levels (egpl)    : 0,0,100
	    Max. egp in percent (megpp)        : 100

  Final mapping parameters (-FM):
	Active (act)                           : yes

	Map perfect matches (mpm)              :  [sxa]  yes
	Max total errors (mte)                 :  [sxa]  -1
	Max mismatches (mmm)                   :  [sxa]  -1
	Max total errors (mg)                  :  [sxa]  -1
	Clean end distance (ced)               :  [sxa]  0

  Contig parameters (-CO):
	Name prefix (np)                                         : B35_denovo_mira
	Reject on drop in relative alignment score in % (rodirs) :  [sxa]  30
	CMinimum relative score in % (cmrs)                      :  [sxa]  -1
	Mark repeats (mr)                                        : yes
	    Only in result (mroir)                               : no
	    Assume SNP instead of repeats (asir)                 : no
	    Minimum reads per group needed for tagging (mrpg)    :  [sxa]  4
	    Minimum neighbour quality needed for tagging (mnq)   :  [sxa]  20
	    Minimum Group Quality needed for RMB Tagging (mgqrt) :  [sxa]  30
	    Minimum coverage percentage (mcp)                    : 10
	    End-read Marking Exclusion Area in bases (emea)      :  [sxa]  1
	        Set to 1 on clipping PEC (emeas1clpec)           : yes
	    Also mark gap bases (amgb)                           :  [sxa]  yes
	        Also mark gap bases - even multicolumn (amgbemc) :  [sxa]  yes
	        Also mark gap bases - need both strands (amgbnbs):  [sxa]  yes
	Force non-IUPAC consensus (fnic)                         :  [sxa]  no
	Merge short reads (msr)                                  :  [sxa]  yes
	    Max errors (msrme)                                   :  [sxa]  0
	    Keep ends unmerged (msrkeu)                          :  [sxa]  -1
	Gap override ratio (gor)                                 :  [sxa]  66

  Edit options (-ED):
	GB read editing (gbre)                      : yes
	Mira automatic contig editing (mace)        : yes
	    Edit kmer singlets (eks)                : yes
	    Edit homopolymer overcalls (ehpo)       :  [sxa]  no

  Misc (-MI):
	Large contig size (lcs)                     : 500
	Large contig size for stats (lcs4s)         : 5000

	I know what I do (ikwid)                    : no

	Extra flag 1 / sanity track check (ef1)     : no
	Extra flag 2 / dnredreadsatpeaks (ef2)      : yes
	Extra flag 3 / pelibdisassemble (ef3)       : no
	Extended log (el)                           : no

  Nag and Warn (-NW):
	Check NFS (cnfs)                            : stop
	Check multi pass mapping (cmpm)             : stop
	Check template problems (ctp)               : stop
	Check SRA read names (csrn)                 : stop
	Check duplicate read names (cdrn)           : stop
	Check Illumina junk in EST (cijie)          : stop
	Check proposed end clipping (cpec)          : stop
	Check max read name length (cmrnl)          : no
	    Max read name length (mrnl)             : 40
	Check average coverage (cac)                : stop
	    Average coverage value (acv)            : 80
	(Phi)X174 contig prefix (x174cp)            : WarnILMNPhiX174_

  Directories (-DI):
	Top directory for writing files   : B35_denovo_mira_assembly
	For writing result files          : B35_denovo_mira_assembly/B35_denovo_mira_d_results
	For writing result info files     : B35_denovo_mira_assembly/B35_denovo_mira_d_info
	For writing tmp files             : B35_denovo_mira_assembly/B35_denovo_mira_d_tmp
	Tmp redirected to (trt)           : 
	For writing checkpoint files      : B35_denovo_mira_assembly/B35_denovo_mira_d_chkpt

  Output files (-OUTPUT/-OUT):
	Save simple singlets in project (sssip)      :  [sxa]  no
	Save tagged singlets in project (stsip)      :  [sxa]  yes

	Remove rollover tmps (rrot)                  : yes
	Remove tmp directory (rtd)                   : no

    Result files:
	Saved as CAF                       (orc)     : yes
	Saved as MAF                       (orm)     : yes
	Saved as FASTA                     (orf)     : yes
	Saved as GAP4 (directed assembly)  (org)     : no
	Saved as phrap ACE                 (ora)     : no
	Saved as GFF3                     (org3)     : no
	Saved as HTML                      (orh)     : no
	Saved as Transposed Contig Summary (ors)     : no
	Saved as simple text format        (ort)     : no
	Saved as wiggle                    (orw)     : yes

    Temporary result files:
	Saved as CAF                       (otc)     : no
	Saved as MAF                       (otm)     : yes
	Saved as FASTA                     (otf)     : yes
	Saved as GAP4 (directed assembly)  (otg)     : no
	Saved as phrap ACE                 (ota)     : no
	Saved as HTML                      (oth)     : no
	Saved as Transposed Contig Summary (ots)     : no
	Saved as simple text format        (ott)     : no

    Extended temporary result files:
	Saved as CAF                      (oetc)     : no
	Saved as FASTA                    (oetf)     : no
	Saved as GAP4 (directed assembly) (oetg)     : no
	Saved as phrap ACE                (oeta)     : no
	Saved as HTML                     (oeth)     : no
	Save also singlets               (oetas)     : no

    Alignment output customisation:
	TEXT characters per line (tcpl)              : 60
	HTML characters per line (hcpl)              : 60
	TEXT end gap fill character (tegfc)          :  
	HTML end gap fill character (hegfc)          :  

    File / directory output names:
	CAF             : B35_denovo_mira_out.caf
	MAF             : B35_denovo_mira_out.maf
	FASTA           : B35_denovo_mira_out.unpadded.fasta
	FASTA quality   : B35_denovo_mira_out.unpadded.fasta.qual
	FASTA (padded)  : B35_denovo_mira_out.padded.fasta
	FASTA qual.(pad): B35_denovo_mira_out.padded.fasta.qual
	GAP4 (directory): B35_denovo_mira_out.gap4da
	ACE             : B35_denovo_mira_out.ace
	HTML            : B35_denovo_mira_out.html
	Simple text     : B35_denovo_mira_out.txt
	TCS overview    : B35_denovo_mira_out.tcs
	Wiggle          : B35_denovo_mira_out.wig
------------------------------------------------------------------------------
Deleting directory B35_denovo_mira_assembly/B35_denovo_mira_d_results ... done.
Creating directory B35_denovo_mira_assembly/B35_denovo_mira_d_results ... done.

Tmp directory is not on a NFS mount, good.

Localtime: Fri Jan 31 15:21:23 2020

Loading MAF B35_denovo_mira_assembly/B35_denovo_mira_d_chkpt/readpool.maf :
 [0%] 
Error around line 147 of file B35_denovo_mira_assembly/B35_denovo_mira_d_chkpt/readpool.maf
Last read name read: NB551081:50:HT2LGAFXY:3:21503:11695:6778/1

Fatal error (may be due to problems of the input data or parameters):

********************************************************************************
* Error in NB551081:50:HT2LGAFXY:3:21503:11695:6778/1 in targettag line RT     *
* SRMr 131 131 = MIRA 0                                                        *
* the entry for the strand (0) is not 0, 1, 2, 3 or .                          *
********************************************************************************
->Thrown: void MAFParse::parseTagData(std::string & acttoken, multitag_t & tag)
->Caught: uint64 MAFParse::loadNextSeqs(uint64 numseqsloaded)

Aborting process probably due to an error in the input data or parameters in the
manifest file. Please check the lines above in this ouput for more information.

For information on subscribing or unsubscribing to mira talk, see:
  http://www.freelists.org/list/mira_talk

CWD: /home/alexander/Annelids/B35/mira_assembly

Thank you for noticing that this is *NOT* a crash, but a controlled program
stop.
Wrapped MIRA process exited with an error.

So I checked the readpool.maf and the read looked like this:

ER
RD      NB551081:50:HT2LGAFXY:3:21503:11695:6778/1
RG      1
RS      TAGATAATTCAAAATTAACAAAAAAAATTAATTGTTAAATTGTTCACAATGAGAATTGCCATTTAGACTACGTTAAAATAAATATTTCCTACTTCACCGGGATCATCCCTGAGTTTTACGAGTTTTTATAGGATTTTTATTATTATTTC
RQ      AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEAEE/EEAEEEEEEEEEEEAEEEEEEEEEEEEE<EEEEE/EEAAEEEEE
TN      NB551081:50:HT2LGAFXY:3:21503:11695:6778
TS      1
RT      SRMr    131     131     =       MIRA    0
RT      SRMr    121     121     =       MIRA    0
RT      SRMr    111     111     =       MIRA    0
RT      SRMr    96      96      =       MIRA    0
RT      SRMr    73      73      =       MIRA    0
RT      SRMr    70      70      =       MIRA    0
RT      SRMr    34      34      =       MIRA    0
RT      SRMr    27      28      =       MIRA    0
RT      SRMr    19      20      =       MIRA    0
RT      SRMr    19      19      =       MIRA    0
RT      CRMr    25      25      =       MIRA    0
RT      CRMr    78      80      =       MIRA    0
RT      CRMr    84      85      =       MIRA    0
RT      CRMr    87      91      =       MIRA    0
RT      CRMr    97      97      =       MIRA    0
RT      CRMr    101     101     =       MIRA    0
RT      CRMr    105     110     =       MIRA    0
RT      CRMr    129     130     =       MIRA    0
RT      CRMr    132     133     =       MIRA    0
RT      CRMr    137     138     =       MIRA    0
RT      CRMr    141     141     =       MIRA    0
RT      CRMr    145     146     =       MIRA    0
RT      CRMr    148     149     =       MIRA    0
RT      MNRr    20      59      =       MIRA    .
RT      MNRr    105     149     =       MIRA    .
RT      HAF7    1       103     =       MIRA    .
RT      HAF6    104     104     =       MIRA    .
RT      HAF7    105     149     =       MIRA    .
RT      KMRF    7       149     =       MIRA    .
RT      CRMr    39      39      =       MIRA    .
RT      CRMr    41      41      =       MIRA    .
ER

All the reads before it have dots in the last column. So is it still possible to resume from checkpoint or will I have to start over?

mirabait error on large genome

I am using MIRA/v5rc1 (pre-built) on a server with 24 cores and 64 GB RAM. I am trying to save the kmer statistics of the latest pig genome but mirabait always crashes towards the end. I guess it must be due to a lack of memory because I have no problems when I only use part of the genome. Any suggestions?

Error with mirabait -j rrna

Hi,

I am trying to run the following command with mira_V5rc1_linux-gnu_x86_64_static:

mirabait -j rrna -I -p $file1.fastq $file2.fastq

The dbdata folder had rfam_rrna-21-1.sls.gz and I changed it to rfam_rrna-21-12.sls.gz. I did run:

./mira-install-sls-rrna.sh rfam_rrna-21-12.sls.gz

But, I still got the following error:

$ mirabait -j rrna -I -p $file1.fastq $file2.fastq

---

• You specified -j rrna, but MIRA could not find the default rRNA hash *
• statistics file which should be located at *
• /gpfs/gsfs9/users/CCRBioinfo/zhujack/local/mira_V5rc1_linux-gnu_x86_64_static/bin/../share/mira/mhs/filter_default_rrna.mhs.gz*

• This is usually the case when you forgot to run the script to install the *
• rRNA data from the MIRA package. *

•                                                                          *
  

• What to do: *
• • if you installed from source: use the 'make install' functionality. *
• • if you installed from a precompiled binaries package: go to the *
• 'dbinstall' directory in that package and type *
• ./mira-install-sls-rrna.sh rfam_rrna-21-12.sls.gz *

---

->Thrown: int mainMiraBait(int argc, char ** argv)
->Caught: main

Aborting process due to an error in the installation of MIRA. Please check the
lines above in this ouput for more information.

The following file exists, no other files in the folder:

/gpfs/gsfs9/users/CCRBioinfo/zhujack/local/mira_V5rc1_linux-gnu_x86_64_static/bin/../share/mira/mhs/filter_default_rrna.mhs.gz

Could you have a look at this and kindly let me know what I have missed? Thanks.

Jack

Preprocessing reads

Hi,

I am new to MIRA and I struggle to understand the docs.
I am trying to follow the de novo RNAseq assembly pipeline but I fail just to preprocess reads as in the doc 6.5.2.
This is my manifest file :
`project = De_novo_MIRA_Vir
job=est,denovo,accurate

readgroup
technology=solexa
autopairing
data=../data/A_1h_viralRaw_1.fastq ../data/A_1h_viralRaw_2.fastq
parameters = -AS:ppo=yes`

This is the error I get :
`
========================= Parameter parsing error(s) ==========================

• Parameter section: '-AS'

• unrecognised string or unexpected character: ppo

• Parameter section: '-AS'

• unrecognised string or unexpected character: yes

• (may be due to previous errors)

===============================================================================

Fatal error (may be due to problems of the input data or parameters):
`

I am sure it is something easy that I did not get.

Thank you very much for your help

Cannot detect clang version on macOS 10.14.4

$ ./bootstrap.sh
$ ./configure
...

checking dependency style of clang++... gcc3

When using clang, you need to have a version >= 3.5. You have only version, aborting.

I checked configure.ac and found the line that retrieves the clang version does not work.

$ clang --version | head -1 | cut -f 3 -d ' '
version

Because

$ clang --version
Apple LLVM version 10.0.1 (clang-1001.0.46.4)
Target: x86_64-apple-darwin18.5.0
Thread model: posix
InstalledDir: /Applications/Xcode.app/Contents/Developer/Toolchains/XcodeDefault.xctoolchain/usr/bin

There is an autoconf macro for detecting C++14 support, which seems to be the purpose of checking the clang version. So rather than check the clang version, how about using the autoconf macro for C++14 support? The macro is AX_CXX_COMPILE_STDCXX_14.

Unfortunately, I cannot figure out how to use this macro, so I decided to file an issue rather than make the change myself and follow it with a pull request.

Build Error

Hello There. I am trying to build in OSX 11.3.1 (I think this is the latest version where I upgraded everything). I am using the example build script.
It goes pretty far with the compilations, but I am getting an error which I need you help to solve.

Thank you very much

sudo ./example_build_miradistribfiles.sh

error :

Making all in mira
/Applications/Xcode.app/Contents/Developer/usr/bin/make  all-am
clang++ -DPACKAGE_NAME=\"mira\" -DPACKAGE_TARNAME=\"mira\" -DPACKAGE_VERSION=\"V5rc2\" -DPACKAGE_STRING=\"mira\ V5rc2\" -DPACKAGE_BUGREPORT=\"\" -DPACKAGE_URL=\"\" -DPACKAGE=\"mira\" -DVERSION=\"V5rc2\" -DHAVE_OPENMP=1 -DHAVE_STDIO_H=1 -DHAVE_STDLIB_H=1 -DHAVE_STRING_H=1 -DHAVE_INTTYPES_H=1 -DHAVE_STDINT_H=1 -DHAVE_STRINGS_H=1 -DHAVE_SYS_STAT_H=1 -DHAVE_SYS_TYPES_H=1 -DHAVE_UNISTD_H=1 -DSTDC_HEADERS=1 -DENABLE64=1 -DHAVE_DLFCN_H=1 -DLT_OBJDIR=\".libs/\" -DYYTEXT_POINTER=1 -DHAVE__BOOL=1 -DHAVE_STDBOOL_H=1 -Drestrict=__restrict__ -DHAVE_MALLOC=1 -DHAVE_REALLOC=1 -DHAVE_STRFTIME=1 -DHAVE_FLOOR=1 -DHAVE_MEMSET=1 -DHAVE_POW=1 -DHAVE_SQRT=1 -DHAVE_FSEEKO=1 -DHAVE_ISBLANK=1 -DHAVE_BOOST=/\*\*/ -DHAVE_BOOST_THREAD=/\*\*/ -DHAVE_BOOST_SYSTEM=/\*\*/ -DHAVE_BOOST_FILESYSTEM=/\*\*/ -DHAVE_BOOST_IOSTREAMS=/\*\*/ -DHAVE_GZOFFSET=1 -DBOUNDTRACKFLAG=1 -DBUGTRACKFLAG=1 -I.  -I../../src    -DPUBLICQUIET -mmacosx-version-min=10.7   -std=c++14 -stdlib=libc++ -I/usr/local/opt/llvm/include -I/usr/local/opt/flex/include -O2  -pthread -I/usr/local/opt/boost/include -fopenmp -MT skim_lowbph.o -MD -MP -MF .deps/skim_lowbph.Tpo -c -o skim_lowbph.o skim_lowbph.C
In file included from skim_lowbph.C:23:
In file included from ./skim.H:32:
In file included from ../../src/mira/hashstats.H:34:
In file included from ../../src/mira/readpool.H:41:
In file included from ../../src/mira/read.H:38:
In file included from ../../src/mira/multitag.H:40:
In file included from ../../src/mira/stringcontainer.H:38:
/usr/local/opt/boost/include/boost/bind.hpp:36:1: warning: The practice of declaring the Bind placeholders (_1, _2, ...) in the global namespace is deprecated. Please use <boost/bind/bind.hpp> + using namespace boost::placeholders, or define BOOST_BIND_GLOBAL_PLACEHOLDERS to retain the current behavior. [-W#pragma-messages]
BOOST_PRAGMA_MESSAGE(
^
/usr/local/opt/boost/include/boost/config/pragma_message.hpp:24:34: note: expanded from macro 'BOOST_PRAGMA_MESSAGE'
# define BOOST_PRAGMA_MESSAGE(x) _Pragma(BOOST_STRINGIZE(message(x)))
                                 ^
<scratch space>:16:2: note: expanded from here
 message("The practice of declaring the Bind placeholders (_1, _2, ...) " "in the global namespace is deprecated. Please use " "<boost/bind/bind.hpp> + using namespace boost::placeholders, " "or define BOOST_BIND_GLOBAL_PLACEHOLDERS to retain the current behavior.")
 ^
**skim_lowbph.C:131:14: error: non-const lvalue reference to type '__wrap_iter<...>' cannot bind to a temporary of type '__wrap_iter<...>'
  for(auto & iphI=SKIM3_lbphs_idsperhash.begin(); iphI != SKIM3_lbphs_idsperhash.end(); ++iphI){
             ^    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
1 warning and 1 error generated.**
make[3]: *** [skim_lowbph.o] Error 1
make[2]: *** [all] Error 2
make[1]: *** [all-recursive] Error 1
make: *** [binaries] Error 2
mv: rename mira*.tar.gz to distribution/mira*.tar.gz: No such file or directory
mv: rename mira*.tar.bz2 to distribution/mira*.tar.bz2: No such file or directory

critical warning

input :

1. bin=output_of_metabat2
2. all the raw reads

script :

## main
# bait raw datas
declare list_paired
for forward in $(ls *R1.fastq.gz)
do
	reverse=$( echo $forward | sed 's/R1/R2/' )
	list_paired+=$(echo "-p $forward $reverse ")
done
bin_name=${bin%.*}
mirabait -b $bin $(echo $list_paired) -N "$bin_name"
# genere manifest.conf
echo "project=$bin_name
job=denovo,genome,accurate
readgroup = PairedEndReasFromMultipleSamples
data = "$bin_name"*R1.fastq "$bin_name"*R2.fastq
autopairing
technology = solexa
parameters = COMMON_SETTINGS -NW:cac=warn -CO:fnic=yes -AS:nop=6:sdlpo=no -KS:fenn=0.3 -NW:cmrnl=warn -GE:not=32
parameters = SOLEXA_SETTINGS -CL:pec=yes" > $bin_name.manifest.conf
# mira assembly
mira -t 128 $bin_name.manifest.conf 

## warning_report :

MIRA warncode: CONCOV_SUSPICIOUS_DISTRIBUTION
Title: Suspicious distribution of contig coverages

- 0 contig(s) with a total of 0 bases (= -nan% of bases in all non-repetitive
  large contigs) have an average coverage less than 75% of the average coverage
  of all non-repetitive large contigs.
- 0 contig(s) with a total of 0 bases (= -nan% of bases in all non-repetitive
  contigs) have an average coverage more than 125% of the average coverage of
  all non-repetitive large contigs.
- 0 contig(s) with a total of 0 bases (= -nan% of bases in all non-repetitive
  contigs) have an average coverage 25% above or below the average coverage of
  all non-repetitive large contigs.
Summary: found 3 indicator(s) for coverage problem(s).

If the DNA you are assembling is bacterial, this could indicate that you sampled
and sequenced DNA from exponential or late exponential phase of a bacterial
population. This leads to a coverage bias toward the origin of replication,
hence false positive detection of repeats, hence an assembly which is more
fragmented than it could be or may have misassemblies in regions located toward
the opposite of the origin of replication.
Only available countermeasure: for your next sequencing project, do not sample
in exponential phase but sample in stationary phase (if possible).


--------------------------------------------------------------------------------

MIRA warncode: CHIMERIC_READS
Title: Readgroup with chimeric reads

MIRA detected chimeric sequences in (at least) one of your readgroups. The
maximum percentage found was 4.78%, which is a complete catastrophe.

Your sequencing provider absolutely needs to get lower numbers, talk to them
about it.

As this is a genome assembly, you should be able to get away with it. But should
you use the same library protocols for sequencing of RNASeq/EST data, this will
create problems.

The reads detected as chimeric are denoted in the 'debris' file in the info
directory, the code they are marked with is CLIP_CHIMERA

--------------------------------------------------------------------------------

Dear Sir,

I used MIRA5 for to bait from a bin file and reassembly with the bait_match, as result i have not found the result file and i get this critical warning. i don't know what to do with this warning.
Could you please give some advises, thank you.

Good day,

Linux binaries for v5rc2?

Hi,
I've been running into issues with the compilation of rc2 (rc1 binaries give me errors) and I was wondering if you could make Linux binaries for rc2 available as well?
Thank you,
Xabi