Giter Site home page Giter Site logo

fasta-parser's Introduction

fasta-parser

Buffer Stream parser from FASTA to JSON.

NPM version Build Status Coveralls Status Dependency Status Gitter chat DOI

Browser

Install

Install fasta-parser with npm:

$ npm install fasta-parser

Alternatively, just include fasta-parser.min.js via a <script/> in your page.

Usage

var fasta = require('fasta-parser')

var fastaData = new Buffer ('>sequence1\n\
ATGCACGTCACGTCAGTACTCGTCAGTAC\n\
>sequence2\n\
CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC\n')

var parser = fasta()
parser.on('data', function(data) { console.log(JSON.parse(data.toString())) })
parser.write(fastaData)
parser.end()
//=>   { id: 'sequence1',
//       seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }
//     { id: 'sequence2',
//       seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }

For a more useful API, check the dependent module bionode-fasta.

Contributing

To contribute, clone this repo locally and commit your code on a separate branch.

Please write unit tests for your code, and check that everything works by running the following before opening a pull-request:

$ npm test

To test on the browser:

$ npm run test-browser
# if you get "No headless browser found" do:
$ npm install -g phantomjs
$ rm ~/.config/browser-launcher/config.json

Please also check for code coverage:

$ npm run coverage

To rebuild and minify the module for the browser:

$ npm run build-browser

To rebuild the documentation using the comments in the code:

$ npm run build-docs

Check the issues for ways to contribute.

Contacts

Bruno Vieira <[email protected]> @bmpvieira

License

fasta-parser is licensed under the MIT license.
Check ChooseALicense.com for details.

fasta-parser's People

Contributors

bmpvieira avatar drpowell avatar katrinleinweber avatar rudani avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

fasta-parser's Issues

consider renaming this module

While exploring bionode modules I found two modules which name suggested the same functionality. Currently bionode has bionode-fasta and this repository (fasta-parser). While bionode-fasta parses a fasta file to a streamable object, this module (fasta-parser) parses fasta to json only. Therefore I think a more accurate naming would be something like fasta2json.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.