Giter Site home page Giter Site logo

r2dm's Introduction

R2Dm

a target primed reverse transcription transposon

Reference sequence is 3607bp long.

 % oligotm $(samtools faidx r2dm.fa r2dm:0-3607 | tail -n+2 | perl -pe 's/\n//')                                                                                                                 ~/r2dm (master) oog
101.095285

TOPO cloning primers

Putative primers.

Forward:

samtools faidx r2dm.fa r2dm:1-21 | tail -1 >primer.5p
# TTGGGGATCATGGGGTATTTG

Reverse:

# design chops off polyA tail and one C
./revcomp $(samtools faidx r2dm.fa r2dm:3558-3585 | tail -1 | tail -c 23 | head -c 21) >primer.3p
# GATCGCGGAGGTATGGAAAT

(Un-chopped version ordered, but may not use initially.)

Secondary primers, somewhere in the middle (1632 bp):

echo AAGGCATTTGATTCTCTATCACATG >primer.mid.5p
./revcomp $(cat ./primer.mid.5p ) >primer.mid.3p

Tm are within 5C. Oligtm is in primer3.

oligotm $(cat primer.5p)
# 63.738920
oligotm $(cat primer.3p)
# 62.018127
oligotm $(cat primer.mid.5p)
# 60.706056

Note that the two-step PCR would yield intermediate products of 1632bp and 1953bp. A full-length product should be 3585bp.

r2dm's People

Contributors

ekg avatar

Watchers

 avatar  avatar  avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.