Giter Site home page Giter Site logo

vim-valign's Introduction

valign

Example mapping in your .vimrc:

let g:Valign_PadChar = "-"
vnoremap gi <esc>:call valign#Align()<CR>

Before:

... CGATCTGACTTGCGACGTACGTAGCACGAT  ...
... ATCTGACTTGCGACGTACGTAGCACGATCG  ...
... CTGACTTGCGACGTACGTAGCACGATCGAT  ...
... GACTTGCGACGTACGTAGCACGATCGATGC  ...

Search for a common "anchor" sequence, for example, /\vGC..CG.

Then, block-select the sequences with <C-V>. For example, place the cursor at the top left "C". Then, v i w CTRL-v j j j

Finaly, trigger the aligner with gi.

After:

... CGATCTGACTTGCGACGTACGTAGCACGAT------  ...
... --ATCTGACTTGCGACGTACGTAGCACGATCG----  ...
... ----CTGACTTGCGACGTACGTAGCACGATCGAT--  ...
... ------GACTTGCGACGTACGTAGCACGATCGATGC  ...

Testing

Testing uses the vim-vspec framework.

# Clone vim-vspec
git clone [email protected]:kana/vim-vspec.git
cd vim-vspect
git checkout master  # make sure you're on master
cd ..

# Clone vim-valign
git clone [email protected]:gshiba/vim-valign.git
cd vim_valign

# Run tests
../vim-vspec/bin/prove-vspec -d .

vim-valign's People

Contributors

gshiba avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.