Giter Site home page Giter Site logo

l0sg / mirna_project Goto Github PK

View Code? Open in Web Editor NEW
0.0 2.0 3.0 4.58 MB

miRNA Discovery Project : simple, easy-to-use, rule-based miRNA candidate discovery with multithread acceleration

Python 100.00%
mirna python rna-seq microrna-sequence microrna

mirna_project's Introduction

miRNA Discovery Project : simple, easy-to-use, rule-based miRNA candidate discovery with multithread acceleration

Version : 1.0 Final

Author : Lee Sang-gil, dept. of Applied Biology & Chemistry, Seoul National University, South Korea

E-mail : [email protected]

Quick Installation & Usage Guide

Need Python 2.7.6 or newer, bowtie, RNAfold

Simply unzip and run main.py like the following:

python main.py -r "reference fasta format genome path" -i "input fasta format RNA-seq path" -o "output path"

For help screen:

python main.py -h

Introduction

This program discovers miRNA candidates, showing mature miRNA-miRNA* duplex and pre-miRNA sequence

It provides alignment information, simplified tabular information, and length distribution of genome-mapped RNA-seq reads

Some filtering procedure, I/O formats, and parameter schemes are inspired by miREAP (by Li Qibin [email protected] Bioinformatics department, Beijing Genomics Institute)

It aims to minimize input file lists and software dependencies, it is written in python script with no installation hassle, and it doesn't require sudo (administrator) privilege to run, which is sometimes a problem when you deploy it at a server

It provides multithread implementation to maximize performance, which is scaled to the cpu threads you use

Albeit there are a number of similar softwares with machine learning techniques achieving high accuracy, this program can be used with in-house data with no extra data, and with simple and fast use

Scoring scheme is defined as simple own criteria, but users can modify the scheme by editing score_seq function in the source code

Software Dependencies

The program needs following software to be installed (in any path):

bowtie (http://bowtie-bio.sourceforge.net/index.shtml)

RNAfold (in ViennaRNA package) (https://www.tbi.univie.ac.at/RNA/)

If both software can be directly executed via terminal (bowtie-build, bowtie, RNAfold), you don't need to specify any parameters in the script

If you have installed these software but cannot directly be executed via terminal, you need to specify the path containing the executables in the script

Parameters

-h, --help

show the help screen and exit

Core

-r --reference

reference genome file location(.fa, .fasta) (default : 'ref.fa')

ex) /home/myname/(...)/my_ref.fa

if no path is specified, it tries to load "ref.fa" in the current folder

-i --input

input small RNA file location(.fa, .fasta) (default : 'smrna.fa')

ex) /home/myname/(...)/my_smrna.fa

if no path is specified, it tries to load "smrna.fa" in the current folderthe file format should look like the following:

>t0000035 3234

GAATGGATAAGGATTAGCGATGATACA

>t0000072 1909

TTGCAGTATGTAGGAAATCAAAACGTTC

(i.e. >name (tab) reads (newline) seq)

most raw RNA-seq data formats are similar to this, but you may need to pre-process the file to match the format

-o --output (default : 'result' subfolder)

output file location

ex) /home/myname/(...)/myoutput

the program generates output files in the specified output location

if the path do not exist, the program tries to make the directory

if no path is specified, results are generated in "result" subfolder in the current folder

-w --bowtiepath

bowtie location (default: command "bowtie" and "bowtie-build")

ex) /home/myname/(...)/bowtie-1.1.2

you need to specify the path CONTAINING the executables "bowtie" and "bowtie-build"

if no path is specified, the program tries to execute with terminal command "bowtie" and "bowtie-build"

-p --RNAfoldpath

RNAfold location (default : command "RNAfold")

ex) /home/myname/(...)/ViennaRNA/bin

you need to specify the path CONTAINING the executable "RNAfold"

if no path is specified, the program tries to execute with terminal command "RNAfold"

pre-miRNA Discovery Criteria

-l --minlength (default : 18)

min. length of mature miRNA

-L --maxlength (default : 26)

max. length of mature miRNA

-u --multloci (default : 20)

max. multiple loci of miRNA matches to reference genome

if the raw RNA-seq read matches to genome with too many locations, it should be considered as repeat, not miRNA candidate

this value is passed to bowtie, and only reads corresponding to this criterion will be mapped

-d --distance (default : 35)

max. distance between miRNA-miRNA* of precursor hairpin loop

if you want to discover "bigger" pre-miRNAs (like plant miRNA or non-canonical miRNA), you can increase this value, but the program will tend to prefer "bigger" pre-miRNAs and "smaller" pre-miRNAs might be discarded

-a --arm (default : 10)

length of arms(both ends) of precursor from mature miRNA

also called as "flank", this value specifies the length of potential drosha-cut sites

the program assumes this value to calculate MFE of putative pre-miRNAs

-f --mfe (default : 18)

min. abs. MFE for valid miRNA precursor

pre-miRNAs whose absolute MFE value are larger than this value (-18 kcal/mol) are considered as novel pre-miRNAs

the program "picks" pre-miRNA with the best normalized MFE near the searching location

pre-miRNAs not passing this criterion are considered "unstable" and discarded

Mature miRNA Scoring Criteria

the site of pre-miRNA passing all the criteria with the best score is selected as putative mature miRNA-miRNA* duplex

if you want to allow more non-canonical miRNA-miRNA* duplex, you may want to increase these values

-m --serialmismatch (default : 2)

max. serial mismatch of miRNA-miRNA* duplex

if any single mismatch site is "too large", it is discarded

-M --multmismatch (default : 2)

max. multiple mismatches of miRNA-miRNA* duplex

if the number of mismatch sites is "too much", it is discarded

-b --serialbulge (default : 2)

max. serial bulge of miRNA-miRNA* duplex

if any single bulge is "too large", it is discarded

-B --multbulge (default : 2)

max. multiple bulges of miRNA-miRNA* duplex

if the number of bulges is "too much", it is discarded

Performance & Memory Efficiency

-t --thread (default : automatic, all threads of the system)

number of CPU threads

if you want to run the program with fewer cpu threads (and less memory), specify the value

-s --step (default : 2)

step size of RNAfold precursor extend loop

the program progressively calculates MFE of putative pre-miRNAs extending the length of the sequence with this specified value

for example, with default settings, the program starts with [ (minlength + arm) * 2 + distance ] and extends the length "left" or "right" automatically

if you increase this value, the program calculates with RNAfold more sparsely and can achieve faster performance, but it could miss the "optimal" choice of pre-miRNA

if you have set larger "distance" value, you may want to increase this value too

-c --mincount (default : automatic, number of unique RNA-seq reads / 500000)

min. read count of smRNA seq displayed at result_mature.txt

the program allocates copy of loaded map data to all threads to maximize performance, so if map data is too large, memory capacity could be an issue, especially if the map file exceeds several hundred MBs

also, if the RNA-seq file has many reads with small count (1~2), result_mature.txt might be hard to read, and result would show less probable miRNA candidates

by default, this value is defined in a heuristic way to achieve stable memory usage and reliable result

if you specify this value, genome-mapped reads with count lower than this value will be considered "insignificant", and will not be used for mature miRNA finding

Miscellaneous & Additional Features : recommended to keep default values

--batch_size (default : number of CPU threads * 3)

size of input data "chunk" for internal processing,

it can be arbitrary value, but (number of cpu threads) * n is recommended

if you increase the size, you COULD earn faster performance (but not always), but the memory usage will be increased

optimal value is depending on the system you are running, so you may want to experiment

--plot (default:false)

draw simple bar plot of length distribution of genome-aligned RNA sequence

if you set this value to true, the program generates "length-distribution.png" file to output path

need matplotlib python package to be installed

mirna_project's People

Contributors

l0sg avatar

Watchers

 avatar  avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.