boum ### vs ### error when running blastn2snp

[lindenb]

boum ### vs ### error when running blastn2snp

[lindenb]

can some lines of /main/data/tmp/infilem7.out please ?
That will be very hard to debug without seeing the content of the XML file.

[bcuser30]

Of course; let me know if you need more than this.

blastn blastn 2.2.24 [Aug-08-2010] ~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402. Prunus_persica_v2.0.a1_scaffolds.fasta.Pp01 lcl|1_0 scaffold_1:46694924 203 1e-06 1 -3 5 2 F 1 lcl|1_0 scaffold_1:46694924 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208

Regards,
Heidi

From: Pierre Lindenbaum [mailto:[email protected]]
Sent: Tuesday, May 3, 2016 11:02 PM
To: lindenb/jvarkit [email protected]
Cc: Hough, Heidi [email protected]; Author [email protected]
Subject: Re: [lindenb/jvarkit] boum ### vs ### error when running blastn2snp (#51)

can I see the first lines of /main/data/tmp/infilem7.out please ?

—
You are receiving this because you authored the thread.
Reply to this email directly or view it on GitHubhttps://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_lindenb_jvarkit_issues_51-23issuecomment-2D216752460&d=CwMCaQ&c=C3yme8gMkxg_ihJNXS06ZyWk4EJm8LdrrvxQb-Je7sw&r=RIEFIUIh4wnoEZFOB_TUkr8FKyuRjnDRS3tlTglKEgo&m=xOV2YjFuxkh1VpNGIGich7NwzmOVNJlK3LRmnwvu2FQ&s=iOz4KXKSttCVkYo4lDJE6ONt-GmFnBzqK_PwuDBCw88&e=

[lindenb]

yes more please ! :-)
I would be interested in the Hit containing the error (may be it's the first Hit ?)

[bcuser30]

This is not a very large file we’re using to test with. Here it is in its entirety. Thank you so much for your prompt response and assistance.

blastn blastn 2.2.24 [Aug-08-2010] ~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402. Prunus_persica_v2.0.a1_scaffolds.fasta.Pp01 lcl|1_0 scaffold_1:46694924 203 1e-06 1 -3 5 2 F 1 lcl|1_0 scaffold_1:46694924 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 203 1 43120809 43121011 1 -1 202 202 203 CAAATGGTTCGACGATGTAGTGGCTGCTGGCTTGAGGGAACCAAATGCTATGGCCTTGTCAACTGCTAGCAAGAATGGAAAACCGTAATATCTGTTTCCTTYGTTACTATGCATCTTTTATTAATACTAAGCTATGTTTCACATATTGTTCTTGCATGTTAGATGAAATTTTATTGGTTTCACTATAGTTTCTAAATTTCTTT CAAATGGTTCGACGATGTAGTGGCTGCTGGCTTGAGGGAACCAAATGCTATGGCCTTGTCAACTGCTAGCAAGAATGGAAAACCGTAATATCTGTTTCCTTCGTTACTATGCATCTTTTATTAATACTAAGCTATGTTTCACATATTGTTCTTGCATGTTAGATGAAATTTTATTGGTTTCACTATAGTTTCTAAATTTCTTT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082 2 lcl|2_0 scaffold_1:42975469 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 203 1 46840557 46840759 1 -1 202 202 203 GTCCCAATTAGCATCCAACAACTAGTTTATTACCAGTCATGTAAGCTCTCAATTTATTTCACTTATACTAATTAAAAGGCATAGTTAATTGATAGCAGCACYGAAAAAGGTACACACAGAAAGCAGTGTGTTAAATGCAACTTACCCTCAGAGGACTTGATGATGACAAAGCATAATCTTTTTCAAGATCATCAGAAAGAATA GTCCCAATTAGCATCCAACAACTAGTTTATTACCAGTCATGTAAGCTCTCAATTTATTTCACTTATACTAATTAAAAGGCATAGTTAATTGATAGCAGCACCGAAAAAGGTACACACAGAAAGCAGTGTGTTAAATGCAACTTACCCTCAGAGGACTTGATGATGACAAAGCATAATCTTTTTCAAGATCATCAGAAAGAATA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082 3 lcl|3_0 scaffold_1:14849516 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 1 203 15823716 15823918 1 1 202 202 203 AGAAACATCATGTCTGAATCGGATCATCAATCCCCTGCTTTTACCTCCCCAAAAATGGTGGTCAAGAAGATCCTCGCCAAGTCCCAATCTGAGGGCGATGGYGCTACTGTCAGGAGAGCCATTGGAAGGTTTGGTTCATGGTTTTTTGCCCATTTGATATTTTTTTCATATTTCCTCTGCTCTGTTTTGGGATTTCAAATCCT AGAAACATCATGTCTGAATCGGATCATCAATCCCCTGCTTTTACCTCCCCAAAAATGGTGGTCAAGAAGATCCTCGCCAAGTCCCAATCTGAGGGCGATGGCGCTACTGTCAGGAGAGCCATTGGAAGGTTTGGTTCATGGTTTTTTGCCCATTTGATATTTTTTTCATATTTCCTCTGCTCTGTTTTGGGATTTCAAATCCT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082 4 lcl|4_0 scaffold_1:8783331 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 1 203 9232590 9232792 1 1 202 202 203 CATTTATATCACCAAACAACGTAAACAAAACAAAATAGAGGATCAATTTTTCCTCGAGGACATCAAAACCCGGGGAAATTTCAAATACGGACAAGAAATGGRATCCCAGAAAAGGAACCAAACAGCGGATCTCGTAATCGATGGCTGTTAGTTGGAGGGTCAACCGGAAATAGTAGAAGGAGAGGAATTGGAGTTTACCTGTG CATTTATATCACCAAACAACGTAAACAAAACAAAATAGAGGATCAATTTTTCCTCGAGGACATCAAAACCCGGGGAAATTTCAAATACGGACAAGAAATGGGATCCCAGAAAAGGAACCAAACAGCGGATCTCGTAATCGATGGCTGTTAGTTGGAGGGTCAACCGGAAATAGTAGAAGGAGAGGAATTGGAGTTTACCTGTG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082

Regards,
Heidi

From: Pierre Lindenbaum [mailto:[email protected]]
Sent: Wednesday, May 4, 2016 8:17 AM
To: lindenb/jvarkit [email protected]
Cc: Hough, Heidi [email protected]; Author [email protected]
Subject: Re: [lindenb/jvarkit] boum ### vs ### error when running blastn2snp (#51)

yes more please ! :-)
I would be interested in the Hit containing the error (may be it's the first Hit ?)

—
You are receiving this because you authored the thread.
Reply to this email directly or view it on GitHubhttps://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_lindenb_jvarkit_issues_51-23issuecomment-2D216898072&d=CwMCaQ&c=C3yme8gMkxg_ihJNXS06ZyWk4EJm8LdrrvxQb-Je7sw&r=RIEFIUIh4wnoEZFOB_TUkr8FKyuRjnDRS3tlTglKEgo&m=CMVCDTSm1oIve3ISa1msVDWqIoOy9cElmBaXGbJ5dkI&s=PIQvnBcp5fq6n82AaOxxbf-hwCKBu12-55ARy5rjC8E&e=

[bcuser30]

Hello Pierre

My researcher says she’s resolved the problem. The file we had been using was generated using Blastall. She created a new one using Blast+. Is there specific software that should be used? Is Blast+ the only format that is correct for use with blastn2snp? Are there others? What are they?

Regards,
Heidi

From: Pierre Lindenbaum [mailto:[email protected]]
Sent: Wednesday, May 4, 2016 8:17 AM
To: lindenb/jvarkit [email protected]
Cc: Hough, Heidi [email protected]; Author [email protected]
Subject: Re: [lindenb/jvarkit] boum ### vs ### error when running blastn2snp (#51)

yes more please ! :-)
I would be interested in the Hit containing the error (may be it's the first Hit ?)

—
You are receiving this because you authored the thread.
Reply to this email directly or view it on GitHubhttps://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_lindenb_jvarkit_issues_51-23issuecomment-2D216898072&d=CwMCaQ&c=C3yme8gMkxg_ihJNXS06ZyWk4EJm8LdrrvxQb-Je7sw&r=RIEFIUIh4wnoEZFOB_TUkr8FKyuRjnDRS3tlTglKEgo&m=CMVCDTSm1oIve3ISa1msVDWqIoOy9cElmBaXGbJ5dkI&s=PIQvnBcp5fq6n82AaOxxbf-hwCKBu12-55ARy5rjC8E&e=

[lindenb]

My researcher says she’s resolved the problem. The file we had been using was generated using Blastall. She created a new one using Blast+.

cool, thanks for the information.
I've never tested the old blastall with my tools. I wouldn't be surprised if the two XML are not the using the same the schema.

Closing this issue now.