nanoporetech/hammerpede

A package for training strand-specific profile HMMs for primer sets from real Nanopore data

hammerpede's Issues

Can the process be resumed from the point the hits_-VNP.fasta (and the other three) have been created

I ran the following command:
hp_bootstrap.py -f adaptors.fa -o hammerpede_output <(gunzip -c ../qscore7.fastq.gz)
And it ran for ~20 hours and finished creating the four hits_.fasta files. However, at this point the script was killed with exit code 137. (unfortunately I lost the error messages). The script called 'spoa' was mentioned in the error messages. Is it possible to resume the process using the hits_.fasta files (and this time I can supply the command with more memory)? If so, could you tell me which script to use please

Hammerpede is stuck, seemingly after starting the 'spoa' stage

I'm running the following command:

hp_bootstrap.py -f telo-prime_adaptors.fa -o hammerpede_output <(gunzip -c ../qscore7.fastq.gz)

It progresses normally at first and takes ~24 hours to make four fasta files, called hits_*.fasta (where * is SSP, -SSP, VNP, and -VNP). It produces the following output:

0it [00:00, ?it/s]Extracting primer regions from reads in /dev/fd/63
49153803783it [17:53:00, 763494.19it/s]
Aligning primer regions using spoa: hammerpede_output/spoa_aln_hits_VNP.fasta

But is then stuck (I think) at this stage, as nothing seems to be progressing now for ~96 hours. The node that this command is running on is running a spoa job, but the spoa_aln_hits_VNP.fasta file which has been created has not been populated with any information.

spoa non-zero exit status 132

I was trying to generate hmm file for future use in pychopper using the command:
hp_bootstrap.py -f /home/anshul1/scratch/seq/our_primers.fas -o $outDir $inDir/${filename}.fastq
(Input reads: 74M)
when I faced the following error:

Aligning primer regions using spoa: /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
/bin/sh: line 1: 327333 Illegal instruction     (core dumped) spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
Traceback (most recent call last):
  File "/home/anshul1/virtual_envs/pychopper/bin/hp_bootstrap.py", line 95, in <module>
    spoa.spoa_align(qd[1], aln)
  File "/home/anshul1/virtual_envs/pychopper/lib/python3.10/site-packages/hammerpede/spoa.py", line 8, in spoa_align
    sp.check_call(cmd, shell=True)
  File "/cvmfs/soft.computecanada.ca/easybuild/software/2020/avx2/Core/python/3.10.2/lib/python3.10/subprocess.py", line 369, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command 'spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta' returned non-zero exit status 132.

My primers were:

$ cat /home/anshul1/scratch/seq/our_primers.fas
>REV
TCTTTCCCTACACGACGCTCTTCCGATCT
>FRW
AAGCAGTGGTATCAACGCAGAGTGAATGGG

More details:

Complete script:

$ cat pychopperHMM_script.sh
#!/bin/bash -l
#SBATCH --error=/home/anshul1/scratch/seq/%x_err_%A_%a.txt
#SBATCH --time=1-10:00:00
#SBATCH --output=/home/anshul1/scratch/seq/%x_out_%A_%a.out
#SBATCH --cpus-per-task=2
#SBATCH --job-name=HMMpychopper
#SBATCH --array=1
#SBATCH --mem-per-cpu=30G
#SBATCH --account=def-noncodo

inDir="/home/anshul1/projects/def-noncodo/anshul1/2023-12-15_seq_JURK_HEK_1"
outDir="/home/anshul1/scratch/seq/pychopper_out5_hmm"
filename="seq_run1n2"

##activating PyChopper virtualenv
module load StdEnv/2020 gcc/9.3.0 parasail python/3.10 spoa/3.4.0
source ~/virtual_envs/pychopper/bin/activate
python -c 'import parasail'
python -c 'import pychopper'
python -c 'import tqdm'
##command:
hp_bootstrap.py -f /home/anshul1/scratch/seq/our_primers.fas -o $outDir $inDir/${filename}.fastq
##pychopper -m hmm -g ${outDir}/FRW_REV.hmm -c primer_config.txt -t 46 -r $outDir/${filename}_report.pdf -S $outDir/${filename}_statistics.tsv -u $outDir/${filename}_unclassified.fastq -w $outDir/${filename}_rescued.fastq $inDir/${filename}.fastq.gz $outDir/${filename}_full_output.fastq

Complete error file:

$ cat HMMpychopper_err_29241032_1.txt

Lmod is automatically replacing "intel/2020.1.217" with "gcc/9.3.0".


Due to MODULEPATH changes, the following have been reloaded:
  1) mii/1.1.2

The following have been reloaded with a version change:
  1) StdEnv/2023 => StdEnv/2020
  2) blis/0.9.0 => blis/0.8.1
  3) flexiblas/3.3.1 => flexiblas/3.0.4
  4) gcc/12.3 => gcc/9.3.0
  5) gcccore/.12.3 => gcccore/.9.3.0
  6) gentoo/2023 => gentoo/2020
  7) libfabric/1.18.0 => libfabric/1.10.1
  8) openmpi/4.1.5 => openmpi/4.0.3
  9) ucx/1.14.1 => ucx/1.8.0

  0%|          | 0/120138152530 [00:00<?, ?it/s]Extracting primer regions from reads in /home/anshul1/projects/def-noncodo/anshul1/2023-12-15_seq_JURK_HEK_1/seq_run1n2.fastq
100%|██████████| 120138152530/120138152530 [24:13:40<00:00, 1377404.48it/s]
Aligning primer regions using spoa: /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
/bin/sh: line 1: 327333 Illegal instruction     (core dumped) spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta
Traceback (most recent call last):
  File "/home/anshul1/virtual_envs/pychopper/bin/hp_bootstrap.py", line 95, in <module>
    spoa.spoa_align(qd[1], aln)
  File "/home/anshul1/virtual_envs/pychopper/lib/python3.10/site-packages/hammerpede/spoa.py", line 8, in spoa_align
    sp.check_call(cmd, shell=True)
  File "/cvmfs/soft.computecanada.ca/easybuild/software/2020/avx2/Core/python/3.10.2/lib/python3.10/subprocess.py", line 369, in check_call
    raise CalledProcessError(retcode, cmd)
subprocess.CalledProcessError: Command 'spoa -l 1 -r 1 /home/anshul1/scratch/seq/pychopper_out5_hmm/hits_REV.fasta > /home/anshul1/scratch/seq/pychopper_out5_hmm/spoa_aln_hits_REV.fasta' returned non-zero exit status 132.

Output folder:

$ ls -lh
total 2.4G
-rw-rw----. 1 anshul1 anshul1  1.9G May 22 09:54 hits_-FRW.fasta
-rw-rw----. 1 anshul1 anshul1  2.1G May 22 09:54 hits_-REV.fasta
-rw-rw----. 1 anshul1 anshul1  2.0G May 22 09:54 hits_FRW.fasta
-rw-rw----. 1 anshul1 anshul1 1019M May 22 09:54 hits_REV.fasta
-rw-rw----. 1 anshul1 anshul1     0 May 22 09:54 spoa_aln_hits_REV.fasta

My virtual env & its installed packages:

$ pip list --local
Package         Version
--------------- -------------------------
biopython       1.81+computecanada
contourpy       1.2.0+computecanada
cycler          0.12.1+computecanada
edlib           1.3.9+computecanada
exceptiongroup  1.2.1
fonttools       4.51.0+computecanada
Hammerpede      0.1.0
iniconfig       2.0.0+computecanada
kiwisolver      1.4.5+computecanada
matplotlib      3.7.2+computecanada
numpy           1.25.2+computecanada
packaging       24.0
pandas          2.1.1+computecanada
parasail        1.2.4+computecanada
Pillow          10.1.0+computecanada
pip             24.0+computecanada
pluggy          1.5.0+computecanada
pychopper       2.7.9
pyparsing       3.0.9+computecanada
pysam           0.22.0+computecanada
pytest          8.2.0+computecanada
python_dateutil 2.9.0.post0+computecanada
pytz            2024.1+computecanada
setuptools      69.2.0
six             1.16.0+computecanada
tomli           2.0.1+computecanada
tqdm            4.26.0
tzdata          2024.1+computecanada
wheel           0.43.0

Any help in resolving the same would be much appreciated