olgabot/abi2fastq

abi2fastq is a small utility to convert Sanger sequencing reads in .abi (applied biosystems) format to FASTQ

abi2fastq

abi2fastq is a small utility to convert Sanger sequencing reads in .abi (applied biosystems) format to FASTQ

Installation

With pip

Using pip, you can grab the latest version of abi2fastq from the Python Package Index.

pip install abi2fastq

Bleeding edge version (for advanced users)

To install this code, clone this github repository and use pip to install

git clone https://github.com/olgabot/abi2fastq.git
cd abi2fastq
conda env create --file environment.yml
source activate abi2fastq-env

Usage

Here is the help output for abi2fastq:

$ abi2fastq --help
Usage: abi2fastq [OPTIONS] FILENAME

  Convert Sanger sequencing format (.ab1) to FASTQ, writes to stdout

  Trimming is performed using the Mott algorithm -
  http://www.phrap.org/phredphrap/phred.html

Options:
  --verbose                  Show progress messages
  --no-trim                  Don't trim nucleotides with error probability
                             >0.05 for 20 or more nucleotides in a row
  --min-trim-length INTEGER  Minimum length of "bad" sequencing scores in a
                             segment
  --max-error-prob FLOAT     Bases with error rates higher than this are
                             likely to be trimmed
  --help                     Show this message and exit.

Example

Here is an example conversion using an .ab1 file included with this repository. Notice that is written to standard out.

$ abi2fastq abi2fastq/test/data/ZN-1_ZNif1__2017-06-07_B01.ab1 
@ZN-1_ZNif1_
ATGCGAAAAACTTTCTGATCAGTTCCTGTTGATTCCCAAGGTATGCATATGGTAGCCGGGCACGACGCCAATGATGCTGTCATAAGCAATAGCGTTGCGCAAGCGCGATTTTCAGGGCTTCTGATCGTGAAAACAGTTCTCGATCATATTCTGCAAAAGACAGAACGCGGCGTCCGATTGCATCCTCTCGCACGGACGGCTAAGGTGAAAAATGAGGTCAACTCTTTCAAGGCCGCACTGAGCTCTCTGGCAAAACACGGGGAATATGCCCCATTCGCGAGACTGCTTAATTTGTCTGGAGTCAACAATCTGGAGCATGGGCTTTTTCCGCAACTTAGTGCGATTGCCCTGGGGGTAGCTACAGCACACGGTAGCACTTTGGCCGGCGTTAACGTCGGTGAGCAATATCAACAACTGCGAGAAGCAGCGACGGAGGCAGAGAAACAACTGCAACAGTATGCCGAGTCTAGGGAACTGGATCACCTCGGTCTGGATGACCAGGAAAAGAAAATTCTCATGAACTTTCATCAAAAGAAGAACGAGATATCATTTCAGCAGACTAATGCGATGGTCACTCTTCGGAAAGAGCGACTTGCTAAACTCACAGAAGCGATAACAGCAGCATCCTTGCCGAAGACATCAGGCCACTATGACGACGACGACGATATTCCCTTTCCGGGTCCGATTAACGATGACGATAACCCGGGTCATCAAGACGATGATCCCACAGACTCCCAGGACACCACCATCCCCGATGTAGTTGTGGATCCTGATGATGGCTCATACGGCGAGTACCAAAGCTATAGTGAGAATGGCATGAACGCCCCGGGACGATTTGGTATTGTTCGACCTCGATGAAGATGACGAGGATACTAAGCCTGTACCCAACCGAAGTACCAAAGGGCG
+
/5E:.1'&&&1VVK/BP)',&,J^PPG^PX^/--+,**4GPP^R^RXX^^^^X^^^P^^^P^^^\\^^R-\^\L\^^^^\>L\X^\R\^^^^^^^\\^^^^\R^^^^\?\^^3L^^\^^^^^^RR\^^^^^^^^\^^^^^^^\MLD^^^\\^^^^^^^RR^^\\^^\^^^^^^^^^\\^^^^^^^^^^^^^^^^\M\^^^\\^^^^^^^^^^^^^^^^\\\\^^^^^\\^^^^^^^^\^^\\^\^^^^^^^^^^^^^^^^^^\^^^^\^^^^^^^^^^^\RL\^^^^^^\^^^^^^^^^\\^\\^^^^^^^^^RR^^^^^XX^XX^^^^^^^^R^^^^^^^^^^^^^^^^^^^^^^^^^RR^^^^^^^^^^^^^^^^^X^^^^^^^^^^^^^^^^^^^^^^^^^^^^^PP^^^^^^^^^^PP^^^^^^^^^^^>A^^^^LGL^P^^^^^^^^V^^^^^^^^^^^P^^^^^^^^^K^^^KHGI^^^^^^^^^ZZHKZZKE?ZZPFPZKOZZVUZZZEVZZZCPZZZ?LTEIZZP9PZPVAKVZVENVZEJZZZ;FZVZVEAEBPVZVUVSZUJBGOLOZZUZZJLUIE<ZGVIZZVGLAZUIZAUVVPJOCZPUUBPZPZVVSVUZHUZZU<ZUVU2>GDZ@UNZG8AIUFVVIG4UV5VM0NQ9VV<LMEZHZZO@ZBOVNMZBD0=DJG?P??HC:MQ@MAC<OTMP:CI??N?>::OEHI:LO<>E>@48QCT?E0?<>>>>>@:>G;TTPP;5OBE?<EJ4LL=>=>>O98?DA>C9O5D>>A8L18J;;8B31J6;>><L>=>L>=>>8DO;>DG;8H>>TOH-E0562>4TA>;5=JJE40>=:+=D08558E>371;==-=7G==5A74G>C@=A1.8K>524?=9::64>B'G+BT6?8

To save the output as a file, use > to redirect the output:

$ abi2fastq abi2fastq/test/data/ZN-1_ZNif1__2017-06-07_B01.ab1 > ZN-1_ZNif1__2017-06-07_B01.fastq