poonlab / highliner Goto Github PK
View Code? Open in Web Editor NEWAn implementation of LANL's Highlighter web app in R for batch processing and scaling
License: GNU General Public License v3.0
An implementation of LANL's Highlighter web app in R for batch processing and scaling
License: GNU General Public License v3.0
Presently printing a session
displays the following:
> ses
<environment: 0x5583ffd49208>
attr(,"class")
[1] "session" "environment"
and calling summary()
raises different errors:
> summary(ses)
Error in order(var_counts, decreasing = F) : argument 1 is not a vector
@Lisa-Monique found environment
as a possible approach to hash-based key-value data structures in R.
Also allow user to use SAM file format as input.
In all cases, we should try to stream the input file and process data "online" instead of reading the entire contents into memory first.
dist.dna
in ape
package)Thank you for this. I have this code trying to visualize an alignment
files <- 'data/dta.fasta.aln'
highline(files[1])
and then I get this error
Error in exists(sequence, envir = data$compressed) :
variable names are limited to 10000 bytes
This could return:
If an NGS data set contains many more reads than available templates (nucleic acids) in the sequencing reaction, then the frequency distribution of variants - and thereby the resulting diversity measures - may be skewed. It might be possible to adjust for this by sampling N reads at random (with replacement?) M times, and then averaging the resulting variant frequencies across the M replicates to yield the expected frequencies.
For example, make a toy example FASTA file to import and compare the parsed result to the expected result.
Unlisted packaged dependency (ggpubr)
art@orolo:~/git/highlineR$ R CMD INSTALL .
* installing to library ‘/home/art/R/x86_64-pc-linux-gnu-library/3.5’
ERROR: dependency ‘ggpubr’ is not available for package ‘highlineR’
* removing ‘/home/art/R/x86_64-pc-linux-gnu-library/3.5/highlineR’
After installing ggpubr
the above command executes properly.
art@orolo:~/git/highlineR/tests$ Rscript testthat.R
── 1. Failure: quality score conversion correct (@test_parser.R#48) ───────────
`convert_quality(intToUtf8(33:73), encoding = "invalid")` threw an error with unexpected message.
Expected match: "'arg' should be one of \"sanger\", \"solexa\", \"illumina1.3\", \"illumina1.5\", \"illumina1.8\""
Actual message: "'arg' should be one of “sanger”, “solexa”, “illumina1.3”, “illumina1.5”, “illumina1.8”"
══ testthat results ═══════════════════════════════════════════════════════════
[ OK: 38 | SKIPPED: 0 | WARNINGS: 0 | FAILED: 1 ]
1. Failure: quality score conversion correct (@test_parser.R#48)
Error: testthat unit tests failed
Execution halted
There must be a lot of redundant calculation after computing the distance between sequence A
and B
, since the third sequence C
must be almost identical to either one - we should be able to reuse a lot of the first calculation.
place public or fake data in folder with example scripts for making plots
Currently displays filenames
I ran into the following error when trying to process a dataset of HIV-1 env sequences:
Error in gsub(master, paste(master, "(m)"), seqs) :
invalid regular expression 'ATGAGAGTGATGGGGATCAAGACGAATTGTCAGCACTCAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGAAGCAACTACTACTCTATTTTGTGCATCAGATGCTAAAGCATATGACACAGAGATGCATAATGTTTGGGCCACACATGCCTGCGTACCCACAGACCCTAACCCACAAGAAATGCAATTAGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAAATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTATTTTAAATTGCGAAATAAAAAACTGCTCTTTCAATGTCTATGCACTCTTTAATACAATAGATGTGATACCAATATATATGTTGACAAATTGCAATACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTCGAACCAATTCCCATACATTATTGTACCCCTGCTGGTTTTGCGATTCTAAAGTGTAAGGATGAGAAGTTCAATGGAACAGGTCCATGTAAAAATGTCAGCTCAGTACAATGTACACATGGAATTAGGCCAGTGGTGTCAACTCAACTGTTGTTAAATGGCAGTCTAGCAGAAAAAGAGGTAGTAATTAGATCTGAAAATTTCACCAACAATGCTAAAACCATAATAGTACAGCTGAAGGACGCTGTAAACATTACTTGTATGAGACCCGGCAACAATACAAGAAAAAGTATAACTATAGGACCAGGGAGTGCATTTTATACATCAATAATAGGAGATATAAGACGAGCACATTGTAATGTTAGTGCAACAAAATGGAACAAGACTTTACATCAGGTAGTTGAAAAACTAAGAAAATTTAATCAATCCGGAGGGGACCCAGAAATTACAATGCATACCTTTAATTGTGGAGGGGAATTTTTCTATTGTAATACAACAAAACTGTTTAA
This issue has come up before, where the solution was to set the option perl=TRUE
.
I've made this fix in the plot.Data
function and it resolves this issue.
Using R environment objects
" Error in order(simil) : argument 1 is not a vector"
Cannot order sequences because no sequences to compare
The plot function should have the following features:
And eventually
Let's try using ggplot
for this.
For example, the current help page for plot.session
lists a number of functions, e.g., data_melt
, that are not exposed for the user. This help page was generated from inline comments in the source code, which is not adequate.
Commit a185d5a
Warning messages:
1: In for (n in impnames) if (!is.null(genImp <- impenv[[n]])) { :
closing unused connection 5 (/home/art/git/highlineR/tests/testthat/test_data/valid/fastq/test.fq)
2: In for (n in impnames) if (!is.null(genImp <- impenv[[n]])) { :
closing unused connection 4 (/home/art/git/highlineR/tests/testthat/test_data/valid/fasta/test.fa)
> plot(ses)
Error in get_legend(plots) : object 'leg' not found
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.