qiukunlong/seeksv

A bioinformatics tool for SV detection and virus integration discovery

seeksv's Issues

Error BAM index

Hi, I'm running into errors in the seeksv getsv step.

When running "seeksv getsv sample.clip.bam $file sample.clip.gz sample.sv.txt sample.unmapped.clip.fq.gz" it gives:
'InputSoftInfoStoreBreakpoint' finished
Bam/sam sample.bam Mean insert size : 182
Mean deviation: 71
'CalculateInsertsizeDeviation' finished
[bam_index_load] fail to load BAM index.
[main_samview] random alignment retrieval only works for indexed BAM files.

My orignal bam file is indexed, and I've also tried to index the generated sample.clip.bam but this did not help.
Any ideas?
Best,

sam parse query name too long

Hi, thanks for the tool - looking forward to using it. It seems seeksv is using the full sequence as the sequence header/name in the getclip stage, and samtools is choking on this when aligning with bwa (i've tried samtools v1.5 and 1.8):

[M::mem_process_seqs] Processed 161232 reads in 3.408 CPU sec, 3.115 real sec
[E::sam_parse1] query name too long
[W::sam_read1] Parse error at line 235
[main_samview] truncated file.

viewing a sam file gives the same issue:

samtools view -c 14140.clip.sam
[E::sam_parse1] query name too long
[W::sam_read1] Parse error at line 235
[main_samview] truncated file.

example read from clip.fq.gz

@AGGCAATATAAAGATTGCTTTCAATAACCAAGAAGAATTAAACAGAATTATCAACACTCTAAAATAAGGGTGTTGATTATTTTTTTATTTAATCAAACTTATCCACAAGGTATTTTGCTATTTTTCTGTTGATTCTCTAAGCTTTTCTAATTTCCACAGTCTGTGGAAAACTTT
AGGCAATATAAAGATTGCTTTCAATAACCAAGAAGAATTAAACAGAATTATCAACACTCTAAAATAAGGGTGTTGATTATTTTTTTATTTAATCAAACTTATCCACAAGGTATTTTGCTATTTTTCTGTTGATTCTCTAAGCTTTTCTAATTTCCACAGTCTGTGGAAAACTTT
+
+;,+CGCFCFFF<F9=6FCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

Any suggestions? Thank you

Multiple threads

Hi,
is it possible to run seeksv with multiple threads?

I could not find this option in the help and in the online material. I am running a job for an RNA-seq experiment with 30M reads and is taking more than 2 days for the getsv part. Is it normal?

Thanks in advance

somatic sv filtering

it seems seeksv generates more somatic SVs than other callers - do you have any suggestion for applying filtering? thanks

output.sv.txt file format Description

I have get the Final SV output named output.sv.txt, while I can't find the file format Description.
Some columns of output.sv.txt is easy to enderstand by its name, some are not. Please add this file format description. Thanks.