synthego-open/ice

Synthego ICE - Inference of CRISPR Editing software

ice's Issues

Can one expand the indel size limit?

I did not find a way to increase the maximum indel size in the site or as an option in the command line version. I am interested in deletions generally longer than 50bp (TIDE's maximum) but perhaps as long as a few hundred bases. Is this something ICE is programmed to handle?

Substitute NNNs in insertions with an actual sequence

Putting this as a new feature request or question, as a lot of our users are asking for it.
In knockin experiments scientists want to check the actual inserted sequence. Are there any plans to have that in results instead of just a sequence of Ns?

Installation Typo

There is an typo in the Readme file describing installation:

pip install sythego_ice

should be

pip install synthego_ice

Data visualization

Hi, I am pretty new to data analysis on gene editing. I have successfully run the code and got the results. But I wonder how should I visualize the result?

Are there any release notes somewhere?

Dear ICE devs,

I just noticed python ice_analysis_single.py --version says 1.2.0. Just curious what's been changed since v1.1.0?

Thanks,

Pei

GitHub link for ICE v3

Hi,

Can you please point me to the GitHub link for ICE v3?

Thanks

Difference in trace.json format

I am currently running synthego-open/ice using the latest docker (I didn't want to explicitly use latest tag): synthego/ice:fix_throwing_out_wildtype_hdr. However, it looks as though the structure of the trace.json file differs from the structure of the trace.json file on your website. For example, when running a batch analysis using the docker version, the trace.json file looks as follows:
{
'ctrl_sample': {'trace_data': [], 'cutsite': #, 'guide_start': #, 'guide_end': #., 'pam_start': #, 'pam_end': #},
'edited_sample': {'trace_data': [], 'cutsite': #}
}

But when I run the same batch on your website and ask for the results back, the format looks as follows:
[
{
'ctrl_sample': {'trace_data': [], 'guide_target': {}, 'cutsites': [{}]}
'edited_sample': {'trace_data': [], 'cutsites': [{}]}
}
]

Am I doing something wrong to not recreate the same trace.json file? This is potentially problematic for me when trying to analyze multiplexed samples where the trace.json should be returned as a list with multiple cut sites.

Confusing error message

Hi there,

one of our recent runs got this error "Control ab1 trace quality too upstream of guide too low", maybe it can be better worded. I am not sure if this is a data issue or a design issue?

Thanks,

Pei

Lowercase guide sequences fail

We want guide sequence searching to be case insensitive

requirements sclearn is deprecated

The sclearn package is deprecated. New package is scikit-learn. Change requirements.txt file to reflect new package name.

docker permission error

docker pull synthego/ice

Cannot connect to the Docker daemon at unix:///var/run/docker.sock. Is the docker daemon running?

Thanks

Analysis failed with 311 in the notes

Hi there,

we use ICE with docker install. It is very easy and fast to use, thanks!

I am curious what exactly the error was if a sample failed analysis. The log shows:

-- analyzing 40 filename.ab1 GGTGAGTGAGTGTGTGCGTG
analyzing 462 number of edit proposals
R_SQUARED 0.998049444356253
discord (aln window): 0.07 after cutsite: 0.13
Exception Caught!
None

I tried on your website, same "311" failed error. Just curious what that means.

Thanks again,

Pei

Exception: Control ab1 trace quality too upstream of guide too low

I get the error in the title. I dont see it listed exactly the same way in the websites troubleshooting guide. The wording is a little weird so Im wondering if its just some small grammar error in the command line version and it really is the error as listed on website (link below) or it actually means something different.

https://www.synthego.com/help/ice-error-control-ab1-trace-quality-scores-too-low-

can you share the part to make the graphics like you have in the web server

i got it working,
can you share the part to make the graphics like you have in the web server
from contrib.txt
thanks

Knockout score for single sample analysis

Hi,

I am trying to extract the knockout score for a sample run as an individual sample. Can you please let me know which json file to parse?

Thanks

pytest fail on v1.1.0

Hello,

It is essential that I run a prior version to validate prior results. Please advise on the pytest failure, also observed in treatment data. Thanks.

-------------------------------------------------- analyzing 8 donor_no_alignment AAGTGCAGCTCGTCCGGCGT
Base dir: /tmp/tmpxqi1g4d4/batch_analysis
Single Sanger analysis failed ord() expected string of length 1, but int found
Traceback (most recent call last):
  File "/home/tdfyoder/GIT/ice_v1.X/ice/ice/analysis.py", line 186, in multiple_sanger_analysis
    result = single_sanger_analysis(*job_args, **job_kwargs)
  File "/home/tdfyoder/GIT/ice_v1.X/ice/ice/analysis.py", line 77, in single_sanger_analysis
    donor=donor)
  File "/home/tdfyoder/GIT/ice_v1.X/ice/ice/classes/sanger_analysis.py", line 126, in initialize_with
    control_sample.initialize_from_path(control_path)
  File "/home/tdfyoder/GIT/ice_v1.X/ice/ice/classes/sanger_object.py", line 80, in initialize_from_path
    phred_scores.append(ord(c))
TypeError: ord() expected string of length 1, but int found
None of the samples were able to be analyzed
False
===================================== 14 failed, 31 passed in 1.82 seconds ======================================

AttributeError: 'MultipleSeqAlignment' object has no attribute 'format'

Hi Thanks for sharing this tool.
After installation when running the example I get the following error:

$ synthego_ice --control ./ice/tests/test_data/good_example_control.ab1 --edited ./ice/tests/test_data/good_example_edited.ab1 --target AACCAGTTGCAGGCGCCCCA --out results/testing --verbose

Synthego ICE (https://synthego.com)
Version: 1.1.1-alpha1
Base dir: /rhampseq/kkiaee/ice/ice/results
Exception Caught!
Traceback (most recent call last):
  File "/home/ccadmin/anaconda3/envs/ice_env/lib/python3.8/site-packages/ice/analysis.py", line 82, in single_sanger_analysis
    sa.analyze_sample()
  File "/home/ccadmin/anaconda3/envs/ice_env/lib/python3.8/site-packages/ice/classes/sanger_analysis.py", line 799, in analyze_sample
    alignment.align_all()
  File "/home/ccadmin/anaconda3/envs/ice_env/lib/python3.8/site-packages/ice/classes/pair_alignment.py", line 94, in align_all
    self.all_aligned_clustal = self.align_list_to_clustal(aln, "control", "edited")
  File "/home/ccadmin/anaconda3/envs/ice_env/lib/python3.8/site-packages/ice/classes/pair_alignment.py", line 80, in align_list_to_clustal
    alignment_txt = aln_objs[0].format("clustal").split('\n', 2)[2]
AttributeError: 'MultipleSeqAlignment' object has no attribute 'format'

I'd appreciate your help in troubleshooting this.

The newest docker image is broken?

Hi there,

we've been using synthego/ice:latest for over 10 months. It's been working well till last week when we did a docker pull and got a new image. All the runs failed with the same python error, and I can reproduce it running test_analysis.py:

E TypeError: ord() expected string of length 1, but int found

ice/classes/sanger_object.py:112: TypeError

The test env is
platform darwin -- Python 3.6.4, pytest-3.4.2, py-1.8.0, pluggy-0.6.0

Now we rolled back to an old image we saved before. But would like to report this bug in case it was overlooked.

Thanks,

Pei

Divide by zero

Hi there,

we recently encountered a problem running ICE (v1.2.0). See the error below:

---

Traceback (most recent call last):
File "/ice/ice/analysis.py", line 82, in single_sanger_analysis
sa.analyze_sample()
File "/ice/ice/classes/sanger_analysis.py", line 834, in analyze_sample
self.simple_discordance_algorithm()
File "/ice/ice/classes/sanger_analysis.py", line 664, in simple_discordance_algorithm
len(unexplained_discord_signal)) * 100)
ZeroDivisionError: float division by zero

Any idea what caused this?

Thanks,

Pei