yu-1011/riboseq_pipeline

A pipeline to process RiboSeq fastqs

PEC RiboSeq Pipeline

Pipeline to process RiboSeq data

This pipeline requires the "ChunkyPipes https://github.com/djf604/chunky-pipes" pipeline framework and will not run self-contained.

The ChunkyPipes framework can be easily installed with::

$ pip install chunkypipes

These pipelines can be installed, configured for the current platform, and run with::

$ chunky install pipeline-name.py
$ chunky configure pipeline-name
$ chunky run pipeline-name [parameters]

For more information on running these pipeline with ChunkyPipes, please refer to the ChunkyPipes documentation <http://chunky-pipes.readthedocs.io>

For questions about this pipeline, please contact Thomas Goodman (tgoodman dot uchicago at gmail dot com)

1.0 Pipeline Overview

Platform Information: Platform | IGSB PDC Name | RiboSeq Operating System | Ubuntu 14.04 LTS (Linux) CPUs | 8 - 32 RAM | 32 - 62 GB Python version | 2.7.6

2.1 Trim Raw Data for Adapters and Quality

Cutadapt

cutadapt -a AGATCGGAAGAGCACACGTCT --quality-base=33 --minimum-length=25 --discard-untrimmed --output={filename}.trimmed.fastq.gz {filename}.fastq.gz> > {filename}_cutadapt.summary.log.txt

Parameters/Arguments: -a | Forward adapter sequence --quality-base | '33' for phred33 or '64' for phred64 --minimum-length | Discards trimmed reads shorter than given length --discard-untrimmed | Discards reads without adapters --output | Path to file output

Program Information: Input | Raw .fastq file Output | Trimmed .trimmed.fastq file Version | 1.13 Source | Compiled from source

Notes:

• Full documentation for Cutadapt is available here.

2.2 Align fastq to rRNA, tRNA, and snoRNA reference to remove them from the trimmed fastq. Keep mRna for alignment

Bowtie2

bowtie2 --seedlen=23 --threads 32 --un-gz={filename}_filtered.fq -x {genome} -U {filename}.trimmed.fastq.gz {filename}.rts.sam -S > {filename}.bowtie2.log 2> {filename}.bowtie2.log2

Parameters/Arguments: --seedlen | --threads | Number of threads to run --un-gz | Output file for Unaligned sequences, to be gzipped --x | Genome reference -U | Input trimmed fastq file -S | File to write SAM alignments to

Program Information: Input | Trimmed .fastq file Output | Trimmed _filtered.fastq file Version | version 2.2.9 Source | Compiled from source

Notes:

• Full documentation for Bowtie2 is available here.

2.3 STAR align kept reads to genome

STAR

STAR --runThreadN 32 --sjdbGTFfile gtfFile --outSAMtype  BAM Unsorted --outFileNamePrefix {filename}_ --genomeDir /path/to/genome/index --genomeFastaFiles --readFilesIn {filename}_filtered.fq.gz --readFilesCommand zcat

Parameters/Arguments: --runThreadN | Number of threads --sjdbGTFfile | gtf reference file --outSAMtype | Formant for output alignment file (bam unsorted) --outFileNamePrefix | Prefix for output filename --genomeDir | a STAR genome index --readFilesIn | input fastq file --readFilesCommand zcat | read a gzipped file

Program Information: Input | mRNA fastq _filtered.fq.gz file Output | Alignment _Aligned.out.bam Version | STAR_2.5.3a Source | Compiled from source

Notes:

• Full documentation for STAR is available here.

2.4 Sort and extract uniquely mapped reads for QC and further analyses

Samtools

samtools view -H {filename}_Aligned.out.bam > header.sam 
samtools view {filename}_Aligned.out.bam | grep -w NH:i:1 | cat header.sam - | samtools view -bS - | samtools sort - ${filename}.uniq_sorted

Parameters/Arguments: -H | View header of file -b | output in bam format -S | Previously this option was required if input was in SAM format, but now the correct format is automatically detected

Program Information: Input | {filename}_Aligned.out.bam Output | {filename}.uniq_sorted.bam Version | 1.4 Source | Compiled from source

Notes:

• Full documentation for samtools is available here.

2.5 evaluate percent reads mapped to each genomic features

SeQC - read_distribution.py

read_distribution.py -r hg19_RefSeq.bed12 -i {filename}.uniq_sorted.bam > {filename}.read_distribution.log

Parameters/Arguments: -r | reference file -i | input bam

Program Information: Input | {filename}.uniq_sorted.bam Output | {filename}.read_distribution.log Version | read_distribution.py 2.6.4 Source | Compiled from source

Notes:

• Full documentation for read_distribution.py is available here.

2.6 Create Codon periodicity charts

Bedtools - intersect

bedtools intersect -a hg19_ccds_exons_plus_start100.bed -b {filename}.uniq_sorted.bam -s -bed -wa -wb > intersect_start100
awk -v OFS='\t' '{print ($2-($14+100))}' {filename}_intersect_start100.bed | sort | uniq -c > {filename}_relative_pos_aggregate.table

Parameters/Arguments: -a | Annotation to be used. -b | input bam -s | Force “strandedness”. That is, only report hits in B that overlap A on the same strand -bed | When using BAM input, write output as BED. -wa | Write the original entry in A for each overlap. -wb | Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by -f and -r.

Program Information: Input | {filename}.uniq_sorted.out.bam Output | {filename}.intersect_start100.bed, {filename}_relative_pos_aggregate.table Version | v2.25.0 Source | Compiled from source

Notes:

• Full documentation for bedtools intersect is available here.

2.7 Read counting

subread: featureCounts

featureCounts -a gencode.v19.annotation.gtf -o {filename}.featureCounts -s 1 {filename}.uniq_sorted.bam

Parameters/Arguments: -a | Annotation to be used. -o | output name -s | Strand specific read counting

Program Information: Input | Bam file {filename}.uniq_sorted.bam Output | Log file {filename}.featureCounts Version | 1.5.2 Source | Compiled from source

Notes:

• Full documentation for featureCounts intersect is available here.

2.8 FastQC

fastqc --outdir={filename} --t {filename}.fastq.gz

Parameters/Arguments: --outdir | where to put --t | number of threads

Program Information: Input | Fastq {filename}.fastq Output | Directory of QC information Version | v0.11.5 Source | Compiled from source

Notes:

• Full documentation for FastQC intersect is available here.