Giter Site home page Giter Site logo

useful_scripts's Introduction

Useful scripts

This repository contains useful tips/tricks/scripts that I have picked up over the years. The are scripts written in

  • bash
  • awk
  • perl
  • R
  • python3

Some of the scripts have been written by my collaborators: Cesar Poot UNAM Bruno Contreras EMBL. Carlos Cantalapiedra

Dependencies

Before using any of the scripts make sure that you have install the following dependencies

sudo apt-get install python3 python3-pip python3-matplotlib \
ipython3-notebook python3-mpltoolkits.basemap
sudo pip3 install -U pip
sudo -H pip3 install --upgrade pandas numpy scipy seaborn 
sudo -H pip3 install -U scikit-learn

Visualization

Bubble plot

Scrip to create a bubble chart from any dataframe contanining either normalized or absolute values.

usage: bubble_chart.py [-h] [-im_format {png,pdf,ps,eps,svg,tif,jpg}]
                       [--im_res dpi]
                       filename

positional arguments:
  filename              Input file dataframe i.e abundances profile

optional arguments:
  -h, --help            show this help message and exit
  -im_format {png,pdf,ps,eps,svg,tif,jpg}, -f {png,pdf,ps,eps,svg,tif,jpg}
                        Output format for images [png].
  --im_res dpi, -r dpi  Output resolution for images in dot per inch (dpi)
                        [dpi].

Running Bubble plot with example data

 python3 bubble_chart.py  data_bubbleplot.tab -f  png -r 300

Customize your script

sns.set(font_scale=1) #change font size  
sns.set_style("whitegrid") #whitegrid to change background to white
plt.figure(figsize=(21,12)) #inches, modify to widen (x) or lengthen (y) --> original was 21,12
plt.tight_layout() #keeps axes names in same figure
bubble_super_mega_and_simpe_plot(df, 20, cmap='bone_r', ylabel='Tax Group (# of genomes)', xlabel='Genes',alpha=0.05)
# alpha = transparency
#cmap= color palete see below
 
#Recomended colors 

cmap='bone_r'
cmap='plasma'
cmap='coolwarm_r'
 
#cmap python = see https://matplotlib.org/3.1.0/tutorials/colors/colormaps.html

Heatmap

python3 heatmap.py -h

usage: heatmap.py [-h] [-f {png,pdf,ps,eps,svg,tif,jpg}] [-r dpi] filename

 This script create a cluster map

positional arguments:
  filename              Input file derived mebs_output with classification

optional arguments:
  -h, --help            show this help message and exit
  -f {png,pdf,ps,eps,svg,tif,jpg}, --im_format {png,pdf,ps,eps,svg,tif,jpg}
                        Output format for images [png].
  -r dpi, --im_res dpi  Output resolution for images in dot per inch (dpi)
                        [dpi].

Example:
    $  python3 heatmap.py data.heatmap.tsv

Horizontal Barplot

R script that was used to plot the number of achaeal genomes by taxonomy described in Baker et al., 2020

The input data data_barplot.tab, looks like this, the scripts keeps the specific order that you want your data to sorted. Dr. Craig Connolly provided valuable input to generate the script.

Phylum	Superphylum	Number of genomes
Heimdallarchaeota	Asgard	66
Lokiarchaeota 	Asgard	63
Unclassified_Asgard	Asgard	37
Thorarchaeota	Asgard	32
Helarchaeota	Asgard	19
barplot.R

Histogram distribution

From a scaffold lenght tabular file see below how to generate sequence length file from multifasta

Compute the lenght

seqkit fx2tab --length --name --header-line sample.contigs.fa >> sample.length.tab
less sample.lenght.tab

name    length
4484_scaffold_11179     2148
4484_scaffold_8359      2609
4484_scaffold_3616      4460
4484_scaffold_7824      2728
4484_scaffold_6736      3024
4484_scaffold_9058      2482
4484_scaffold_8774      2534
4484_scaffold_4047      4173
4484_scaffold_9826      2344
usage: hist.py [-h] [-im_format {png,pdf,ps,eps,svg,tif,jpg}] [--im_res dpi]
               filename

positional arguments:
  filename              lenght file

optional arguments:
  -h, --help            show this help message and exit
  -im_format {png,pdf,ps,eps,svg,tif,jpg}, -f {png,pdf,ps,eps,svg,tif,jpg}
                        Output format for images [pdf].
  --im_res dpi, -r dpi  Output resolution for images in dot per inch (dpi)
                        [dpi].

Example:
$  python3 histplot.py  sample.lenght tab

Replace names from a phylogenetic tree

perl Replace_tree_names.pl mapping_file tree > renamed_tree

Fasta file processing

Split fasta

Requires biopython

pip3 install biopython

Script that is useful if you have a large fasta file and you want to split it into small files of the same size

python3 split_fasta.py

usage: split_fasta.py [-h] [-p PARTS] fastafile

Split a fasta file according in almost equal parts based on total base/residue
count. Stores a numpy array that contains the lengths of the sequences in the
file

positional arguments:
  fastafile             Fasta file to split

optional arguments:
  -h, --help            show this help message and exit
  -p PARTS, --parts PARTS
                        Number of parts to slice the file [10]

Multifasta general stats

If you have a directory contanining fasta files (fa: either faa or fna) compute several stats, that are important when describing MAGs See Table 1 Preprint De Anda et al., 2020

for i in *.fa; do seqkit stat $i  >> stats; done
for i in *.fa ; do perl gc.pl $i >$i.gc.tab ; done

#Sum the scaffold GC and get the average 

for i in *.tab; do awk '{sum+= $2; n++ } END { if (n > 0) print sum / n; }' $i > $i.GC.average ; done
 

Generate sequence length file from multifasta

Option 1 awk

Obtained from here

cat file.fa | awk '$0 ~ ">" {if (NR > 1) {print c;} c=0;printf substr($0,2,100) "\t"; } $0 !~ ">" {c+=length($0);} END { print c; }' 
awk '$0 ~ ">" {if (NR > 1) {print c;} c=0;printf substr($0,2,100) "\t"; } $0 !~ ">" {c+=length($0);} END { print c; }' file.fa

Option 2 Seqkit

seqkit fx2tab --length --name --header-line file.fa >> file.lenght 

Option3 samtools

samtools faidx file.fa  |  cut -f1-2 file.fa.fai > file.lenght.tab

Convert fasta into 1 lners

From this 

> header 1
ATGCAATGCATG
ATGCCCGGTAGT
TTATAGAGATAG

to this 

> header 1 
ATGCAATGCATGATGCCCGGTAGTTTATAGAGATAG
perl -lne 'if(/^(>.*)/){ $head=$1 } else { $fa{$head} .= $_ } END{ foreach $s (sort(keys(%fa))){ print "$s\n$fa{$s}\n" }}' file.fa > file1ne.fa 

Average length of multifasta

perl -lne 'if(/^(>.*)/){$h=$1}else{$fa{$h}.=$_} END{ foreach $h (keys(%fa)){$m+=length($fa{$h})}; printf("%1.0f\t",$m/scalar(keys(%fa))) }' file.fa

Keep sequences of certain lenght

In this case we are keeping sequences >100 bp

perl -lne 'if(/^(>.*)/){ $head=$1 } else { $fa{$head} .= $_ } END{ foreach $s (keys(%fa)){ print "$s\n$fa{$s}\n" if(length($fa{$s})>100) }}' file.fa > file100.fa

Change the headers with the name of the name of fasta file

 perl -lne 'if(/^>(\S+)/){ print ">$ARGV $1"} else{ print }' file.fa > file_renamed.fa

Histogram of total number of sequences in a large genomic dataset

Let's suppose that you have thousands of genomes and you want to compare the total number of sequences in your genomic dataset. If all your genomes are either .faa or .fna extension, you can use the following one-line command to count the number of sequences and generate a histogram. You can change the figure to pdf, just change pdf("seq.pdf");

grep -c ">" *.faa  | sed 's/:/\t/g' | cut -f 2 | Rscript -e 'data=abs(scan(file="stdin")); png("seq.png"); hist(data,xlab="secuences")'

Remove fasta sequences from list of headers

It requires a list of headeres to remove from a fasta file

Option 1 python script

python3 remove_sequences.py file.fa sequence_to_remove.txt > file_filtered.fa 

Option 2 grep

grep -v -f sequence_to_remove.txt file.fa  > file_filtered.fa 

Extract fasta sequences from list of headers

Option 1 pullseq

pullseq -i file.fa -n  sequences_to_extract.txt > extracted_sequences.fa

Option 2 samtools

cat sequences_to_extract.txt  | xargs -n 1 samtools faidx file.fa >> extracted_sequences.fa 

Option 3 bedtools

Extract fasta with coordinates

sreformat fasta file.fa > file.reformat.fna
bedtools getfasta -fi file.reformat.fna -bed sequences_to_extract_coordinates.tab -fo file_out.fa

Description of PFAM identifiers

  1. Create a list of PFAM identifiers
head identifiers.txt

PF13243
PF13249
PF02458
  1. Run the following commands, originally created by Dr. Carlos Cantalapiedra and incorporated in MEBS
cat identifieres.txt | while read  pfam; do
desc=$(curl http://pfam.xfam.org/family/"$pfam"/desc | head -1);
printf "$pfam\t";
printf "$desc\n";
done 2> /dev/null \
> identifiers.desc.tab

Join files

Take a column of 1 file and another column from another file and create a new file with those columns No need for matching column

paste <(awk '{print $1}' file1.txt ) <(awk '{print $2}' file2.txt ) > file3.txt

Download genomes from a list ("ftp_GCA_download.txt") of ftp links

for next in $(cat ftp_GCA_download.txt); do wget  "$next"; done

or you can do wget -i ftp_GCA_download.txt

Print duplicates in a column ($1 = column 1)

awk 'x[$1]++ == 1 { print $1 " is duplicated"}'

Cut columns from 1 file and create a new file with those columns

cut -f2,3 file1.txt > file2.txt

Search "pattern" and add "replace_pattern" at the beginning of the line (^)

sed '/pattern/ s/^/replace_pattern/' file.txt

Search "pattern" and replace the 2nd occurrence of it (/2') with "replace_pattern"

sed 's/pattern/replace_pattern/2' file.txt

Delete all characters after the first space

This is very useful if you have a long header in fasta sequences and you want to get rid of all the characters that aren't useful

sed 's/\s.*$//' file.fa > file2.fa

Verifying empty columns

In a file of 2 columns, if 2nd column of file is blank, print 1st column followed by "Your Words", otherwise print 1st and 2nd column, create new file of all this output

awk '{if (!$2) {print $1,"YourWords"} else {print $1, $2}}'  > file.tsv

Download genomes from ncbi

Genome browse overview https://www.ncbi.nlm.nih.gov/genome/browse/#!/overview/

Genbank assembly summary file

wget http://ftp.ncbi.nlm.nih.gov/genomes/genbank/assembly_summary_genbank.txt

Get the complete and latest genomes from assembly summary genbank

awk -F "\t" '$12=="Complete Genome" && $11=="latest"{print $20}' assembly_summary_genbank.txt

Download protein sequences by using a list of NCBI identifiers

Conda is required to use Entrez this way.

#Create an environment in which you can add Entrez Direct
conda create --name entrez

#Activate this new environment
conda activate entrez

#Install Entrez
conda install -c bioconda entrez-direct

#Compile a list of Accession numbers from NCBI (PROTEINS)

less list.txt

ABO08866.1
AFA39020.1
AFA39042.1
AFI78392.1
AOQ24367.1
APC08827.1
ATY72478.1

#Change file to comma separated instead of column
cat list.txt | tr "\n" "," | sed 's/,$//' > list.csv 

less list.csv 

ABO08866.1,AFA39020.1,AFA39042.1,AFI78392.1,AOQ24367.1,APC08827.1,ATY72478.1

#Make a usable script from the list

sed 's/^/efetch -db protein -format fasta -id /' list.csv > list.sh

less list.sh

efetch -db protein -format fasta -id ABO08866.1,AFA39020.1,AFA39042.1,AFI78392.1,AOQ24367.1,APC08827.1,ATY72478.1

#Run the new script
bash list.sh > list.fa

Run a jupyter notebook remotely

Modified from Huan Fan's github

  1. Create an alias in your .bash_profile or .bashrc file with the information of your server
 alias server_jupyter='ssh -p XX  -L 8000:localhost:8888 [email protected]. XXX'
  1. Once in your server set a secure password to acess your notebooks
jupyter notebook password
  1. Start jupyter on the remote server
jupyter notebook 
  1. It asks you whether you “Accepting one-time-token-authenticated connection from 127.0.0.1”. I answered ‘__A__laways’ but next time it kept asking me… Then it complains:
	Jupyter Notebook requires JavaScript.
   		Please enable it to proceed.  
  1. Just ingore it buy entering Q. Then your token would be given on the last line, some thing like:
http://localhost:8888/?token=5640c991ffc0c0c6071e9f0d0100d7204e4b05a6d400c440
  1. Access from your local browser Replace 8888 with 8000, since the later is the port we opened for your local machine, so go to
http://localhost:8000/?token=5640c991ffc0c0c6071e9f0d0100d7204e4b05a6d400c440 

on your local browser and you are ready to go!

Download sequences from a TGRFAM markov model

You can use

Uniprot

or

NCBI

Retrieve taxonomy categories from NCBI Taxonomy

After searching several options including this package in R, I came across a super friendly to use plattfrom taxonkit - A Cross-platform and Efficient NCBI Taxonomy Toolkit

After installing it, download and uncompress these NCBI taxonoomy file

ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz

I downloaded and tar -xvzf the directory in /home/valdeanda/DB/TAXID

Your input file, in this case IDs.txt should look like this

02125
1111708
111780
111781
1147
1284629
165597
1666905
1807358
1827144
1920663
1925591
1933929

To run taxonkit run this

taxonkit lineage --data-dir /home/valdeanda/DB/TAXID/ IDs.txt > IDs.taxonomy.tab

Separate a long fasta-file into many separate single fasta sequences

Many options are available here, the one that works for me is this one

while read line
do
    if [[ ${line:0:1} == '>' ]]
    then
        outfile=${line:1:11}.fa 
        echo $line > $outfile
    else
        echo $line >> $outfile
    fi

done < myseq.fa

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.