hillerlab/reforge

Regulatory Element Forward Genomics to associate transcription factor binding site divergence in regulatory elements with phenotypic differences between species

reforge's Issues

Versioned package release request

I'm working to make Reforge available on Bioconda.

Please refer. -> https://docs.github.com/en/repositories/releasing-projects-on-github/managing-releases-in-a-repository#creating-a-release

I need your help creating a versioned release to use for the Bioconda recipe. Once this is added to Bioconda, it'll also be made available as a Docker container from Biocontainers, and as a Singularity image from the Galaxy Project. The Bioconda bot will also recognize future releases and automatically update the recipe.

Please let me know

Thanks
Jay

Bioconda package for REforge

Hi Team,

I would need to make this REforge as a bioconda package.

Kindly let me know what are the prerequisities for doing this installation and steps. So i can prepare the staging environment and push to bioconda channel.

Thanks
Jay

Release Versions

It would be handy, especially for HPC environments, if there was release versions tagged in this software.

how to prepare motifs.wtmx file

Hi, Hiller

Now, I had the transcription factor for eye development. I want to know how to get the motifs.wtmx file.
Could you please give me detail instructions.

Thank you.

test error

hello，Michael
Thanks for your wonderful software.
In recent days, I want to use it for my analysis. I had installed it very well follow your instruction.

$REforge.py -h
usage: REforge.py [-h] [--scorefile SCOREFILE] [--windowsize WINDOWSIZE]
                  [--background BACKGROUND] [--scrCrrIter SCRCRRITER]
                  [--no_ancestral_filter] [--no_branch_filter] [--no_fixed_TP]
                  [--filter_branch_threshold FILTER_BRANCH_THRESHOLD]
                  [--filter_GC_change FILTER_GC_CHANGE]
                  [--filter_length_change FILTER_LENGTH_CHANGE]
                  [--alignment ALIGNMENT] [--verbose] [--debug]
                  treefile motiffile lossfile elementfile

Analyses transcription factor motifs with respect to their differences in
binding within a phylogeny of CRM sequences and the associated phenotype

positional arguments:
  treefile              phylogenetic tree given in newick format
  motiffile             wtmx file containing all transcription factor motifs
  lossfile              file listing trait loss species; one line per species
  elementfile           file listing putative elements; one line per fasta
                        file (.fa or .fasta)

optional arguments:
  -h, --help            show this help message and exit
  --scorefile SCOREFILE
                        name of score file
  --windowsize WINDOWSIZE, -w WINDOWSIZE
                        windowsize to be used for element scoring
  --background BACKGROUND, -bg BACKGROUND
                        background file - passed into the score function
  --scrCrrIter SCRCRRITER
                        corrects stubb score with average score of <number> of
                        shuffled sequences. Default is 10
  --no_ancestral_filter
                        elements not are filtered if the ancestral element
                        scores <= 0
  --no_branch_filter    branches are not filtered if start and end score <=
                        filter_branch_threshold
  --no_fixed_TP         Stubb's transition probablities are not fixed on the
                        ancestral sequence
  --filter_branch_threshold FILTER_BRANCH_THRESHOLD
                        Default is 0
  --filter_GC_change FILTER_GC_CHANGE
                        if set, branches with a GC content change above the
                        threshold are filtered
  --filter_length_change FILTER_LENGTH_CHANGE
                        if set, branches with a relative length change above
                        the threshold are filtered
  --alignment ALIGNMENT
  --verbose, -v
  --debug, -d

But, I met some warnings when running the example test.

WARNING:root:Error in score_sequence_with_stubb: Command 'stubb_noPseudoCount CTGCTCCTTTTGCGTCTACTAAGAAGTTACTTATGTAACATGTTACATCGGGACTTGTTGGCCGTAAGTCGTTGAATGCTGGTACTATTAGGTGTCCTGCGATATTCACTAACGCGTTGAGGCACATCCAATCACAGCTGCATTCCCGACAGTCTGACACCGTCAATTAAGAATGTCACGTGAGGGCACCT data/motifs.wtmx 200.0 1  -b /Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/example/background//gc0.47/gc0.47.fa -brief -seq' returned non-zero exit status 1.
WARNING:root:Error in score_sequence_with_stubb: Command 'stubb_noPseudoCount ATACTCCTTATAAGTTCCTCTTGTACTCATATGCTCTGACAGTGGCTCAATTGTTTTCGGGCCTTCATAAATGGCAGATATGCAGGGGCCCGACCTATTAAACCTAGTTTAGACCCGAAGAGCACGAATGGCGCATCCGTGGCTTCACAAGATAGGTAGTTGTTAACGGGTCTACTGTCCTATTCGCGCTA data/motifs.wtmx 200.0 1  -b /Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/example/background//gc0.47/gc0.47.fa -brief -seq' returned non-zero exit status 1.
WARNING:root:Error in score_sequence_with_stubb: Command 'stubb_noPseudoCount CTACTTTGCACGTTACGCTCGCCAGTAATAGTGGATGACAGAAGCCTCTAGAGCAGTTTAGTCGCCCAATCTGAAACAGAACGTAACATTCTCTTGGAGGGTCGGGTTCTTCGACATCTCGAAATGGTGTACCATGTATCTATTACTAGGCCATCCGCATGTCGAATTTATACTACCCTGGTTGTGTCGCT data/motifs.wtmx 200.0 1  -b /Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/example/background//gc0.47/gc0.47.fa -brief -seq' returned non-zero exit status 1.
Traceback (most recent call last):
  File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/REforge_branch_scoring.py", line 172, in <module>
    sys.exit(__score_branches())
  File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/REforge_branch_scoring.py", line 165, in __score_branches
    anc0filter=not args.no_ancestral_filter)
  File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/REforge_branch_scoring.py", line 95, in traverse_tree
    scrCrrIter=scrCrrIter, keepFiles=True)
  File "/Bio/home/Yanglab/Yuzhenpeng/opt/biosoft/REforge/Scoring_utilities.py", line 184, in score_sequence_with_stubb
    if scrCrrMthd: assert r_score == 0
AssertionError

Could you give me some help.
Thank you.

"gmake -f nm_gnu.mak" command fails due to function in tmt1.cpp

I am trying to install REforge in linux and am getting a fatal error whenever I try to build stubb using the command "gmake -f nm_gnu.mak."

Here are the error messages:
tmt1.cpp: In function ‘void trymat1()’:

tmt1.cpp:167:23: error: no match for ‘operator*’ (operand types are ‘int’ and ‘GenericMatrix’)
GM = M; GM += 2 * GM; GM -= 3 * M; M1 = GM; Print(M1);
~~^~~~

tmt1.cpp:167:37: error: no match for ‘operator*’ (operand types are ‘int’ and ‘Matrix’)
GM = M; GM += 2 * GM; GM -= 3 * M; M1 = GM; Print(M1);
^

Do you know what causes this error or if there's a fix?

Thank you!

Luisa