This site is only for distributing binary files.
quwubin / mfeprimer-3.0 Goto Github PK
View Code? Open in Web Editor NEWPCR Primer Quality Control
Home Page: http://www.mfeprimer.com/
PCR Primer Quality Control
Home Page: http://www.mfeprimer.com/
This site is only for distributing binary files.
Is there any way to set a maximum delta or range between forward and reverse primers for predicted amplicons when using the mfeprimer spec
command? Or is it possible to ad this feature in future releases?
As an example, I set my -t
flag to 45C. Some of my predicted amplicons have very divergent Tms (FpTm - 64C, RpTm - 48C). The ability to filter predicted amplicons based on Tm range (i.e., ± 5C) would be very beneficial.
Given two primer sequences P1 and P2 with largely complementary 3' ends, I would expect that dimers are formed by overlapping 3' ends. However, mfeprimer dimer
(v3.2.0) also predicts a dimer species where the 3' end of P1 overlaps the non-complementary 5' end of P2 (see 'Dimer 2' and 'Dimer 3' in log file). Why is this?
i want to learn the source code and want to study in the source code, but I cannot find the code in github and homepage
Dear all,
I want to generate the 120 nt probe sequences on my own genomes. I also have a look at the OligoMiner
tool (https://github.com/beliveau-lab/OligoMiner) . I will chose MFEprimer
in my study. However, some questions confused me about it, such as how to set the k-mer size, when I set the k-mer size to 18, the program (mfeprimer-3.2.1-linux-amd64 index -k 18 -i reference.fa) always run out of memory. Some other parameters about the probe sequences quality control, such as tm cutoff in mfeprimer-3.2.1-linux-amd64 dimer
. In my experiment, the probes will be added and hybridised to the prepared library at 65°C (If the tm of the structure is lower than my reaction conditions, then this structure will not cause any problems). I was wonder that if I should set the tm to 65 when running mfeprimer-3.2.1-linux-amd64 dimer
. Also, about the delta G parameters in mfeprimer-3.2.1-linux-amd64 hairpin
, I know that more negative of delta G will be problematic. Hope you can give me some suggestions. Thank you very much.
Best wishes,
Zheng zhuqing
Thanks to UCSC Genome Download page, it has a well prepared comprehensive databases for most of species. We will add all these databases for MFEprimer-3.0.
Databases not covered by UCSC Genome Download page, please let me ([email protected]) know, I will add the database as soon as possible.
Software version:MFEprimer-3.2.7
When a batch job is executed, some results will be empty, and when run separately, some results will be returned
mfeprimer -i 03_true_primer/primer0.fa -d pos_index/positive.fa -o out_03_true_primer/primer0.fa.out -c 10
mfeprimer -i 03_true_primer/primer1.fa -d pos_index/positive.fa -o out_03_true_primer/primer1.fa.out -c 10
mfeprimer -i 03_true_primer/primer10.fa -d pos_index/positive.fa -o out_03_true_primer/primer10.fa.out -c 10
mfeprimer -i 03_true_primer/primer100.fa -d pos_index/positive.fa -o out_03_true_primer/primer100.fa.out -c 10
mfeprimer -i 03_true_primer/primer1000.fa -d pos_index/positive.fa -o out_03_true_primer/primer1000.fa.out -c 10
mfeprimer -i 03_true_primer/primer1001.fa -d pos_index/positive.fa -o out_03_true_primer/primer1001.fa.out -c 10
...
Hello, it is very nice to be able to use MFEprimer to verify the dimerization, hairpin structure and specificity of the primer sequences。I found that the web version of MFEprimer can implement primer design, but the command-line did not find the function to implement primer design.
Looks like the Darwin amd64 version is not compatible with Apple latest models. Not that urgent, but it will be very helpful, maybe in next update?
I run mfeprimer 3.2.2 with a fasta file which has 5000s sequences, but it encountered an error while running, below is the detailed information of the error:
panic: runtime error: slice bounds out of range [:-3]
goroutine 95860623 [running]:
github.com/quwubin/bio/mfeprimer.matchPair(0xc000136120, 0x2a, 0xc00023d860, 0xc000276b40, 0xc06957f9a0, 0x4, 0x4, 0xc096ccf128, 0x3, 0x3, ...)
/Users/quwb/quwubin/bio/mfeprimer/mfeprimer.go:1167 +0x1ab2
github.com/quwubin/bio/mfeprimer.searchPairedAmpliconsParallel.func2(0xc001eb41e8, 0x0)
/Users/quwb/quwubin/bio/mfeprimer/mfeprimer.go:980 +0x290
golang.org/x/sync/errgroup.(*Group).Go.func1(0xc089fd2210, 0xc692af33e0)
/Users/quwb/gocode/pkg/mod/golang.org/x/[email protected]/errgroup/errgroup.go:57 +0x59
created by golang.org/x/sync/errgroup.(*Group).Go
/Users/quwb/gocode/pkg/mod/golang.org/x/[email protected]/errgroup/errgroup.go:54 +0x66
while I see the log, the program stop running when testing AGACGATGCTGCTGCT vs. AGTCGATCATCGGGATTCAGCAGCAG
Then I tried running this two sequences using different versions of mfeprimer, but it not works. How can i get the right way to deal with this problem?
Thank you so much.
Hello - thanks for this great software. Would you consider providing x86 binaries for those of us still living in the past? It would be so appreciated if you could.
Hello,
Would it be possible to add the --json/-j output flag for mfeprimer hairpin?
An error occurred in a allocated memory, while I use a rice genome(400Mb file size) to create index with 50Gb memory. Is the memory to low for creating index ? if is, it need to much memory. Wish for you help! here is the error info blow.
created by github.com/quwubin/mfeprimer/cmd.makeIndex in goroutine 1 /Users/quwb/gocode/src/github.com/quwubin/mfeprimer/cmd/index.go:292 +0x4e0 runtime: out of memory: cannot allocate 4194304-byte block (3916169216 in use) fatal error: out of memory goroutine 35 [running]: runtime.throw({0x8317425, 0xd}) /Users/quwb/local/go/src/runtime/panic.go:1077 +0x4d fp=0x9ed1d08 sp=0x9ed1cf4 pc=0x8083dcd runtime.(*mcache).refill(0x555afca8, 0x5)
Hi,
Would it be possible to add a column to the CLI full quality control output that designates the primers involved in the predicted amplicon? This would be similar to the web server version of MFEprimers "Fp x Rp" column.
Hi, the Tm filter seems to only filter amplicons. It would be great to have it also filter bindings, dimers, and hairpins. Would that be difficult to add? Maybe different flags? Is there is a reason that it doesn't?
Thanks!
With the same input primer fasta and the same indexed database, MFEprimer gives different output in different run.
The amplicons and the pair of primers could change for some reason.
Is there some bugs to be fixed?
diff output/test1.txt output/test.txt
312c312
Amp_11 primer1 + primer2 ==> chr:986768-988086
Amp_11 primer1 + primer3 ==> chr:986768-988086
or
Amp_11 shows in the first run output but not in the second one.
Hi, I have 72 primers and I use mfeprimer for primer specific analysis. The output file size in json format is quite large (5.2 GB json.gz) and it is very inconvenient to use Python for further analysis, mainly because of the lack of memory due to the large file size.
With default conditions, giving two fastas which are constructed by the same sequences but in the different order, mfeprimer dimer
(not matter 3.2.5 or 3.2.0 or 3.2.3) will gives different outputs.
Part of fasta looks like this:
The other fasta looks like this:
I pretty sure the fastas are composed of the same sequences.I check it by python:
But what I got with command mfeprimer dimer -i temp.fa -p
are different outputs:
It really confused me a lot. Are there any special rules for input fastas?
Thanks!
Hi,
I was trying to index a maize genome (2.5 GB) for checking specificity. However, mfeprimer filled up all the 70 GB of disk space in my laptop. I estimate that for the 2.5GB genome I would need a 400 GB index. Should I expect the index to be this huge?
When I execute mfeprimer index -h
, one of the flags tell me:
-m, --memory float memory percent to use, e.g. 70 for 70% (default 70)
But when I index my genomes (~70,000 SARS-CoV-2 genomes), my memory usage exceeds 70%. The command I used was:
mfeprimer index -i sc2.fasta
Image shows 59.7gb being used out of 62.5gb (95.5% of memory usage).
When running mfeprimer index -i hs37d5.fa
get the following error
panic: runtime error: index out of range [0] with length 0
goroutine 1 [running]:
github.com/quwubin/mfeprimer/cmd.write2DB({0xc00001e0d8, 0x14}, {0x0, 0x0, 0x4?}, {0x0, 0x0, 0x43adc20?}, 0x40000)
/Users/quwb/quwubin/mfeprimer/cmd/index.go:591 +0x645
github.com/quwubin/mfeprimer/cmd.makeIndex({0x2087ae853, 0xb}, 0x9, 0x10, 0x4c4b40, 0x4051800000000000, 0x0)
/Users/quwb/quwubin/mfeprimer/cmd/index.go:330 +0x6d8
github.com/quwubin/mfeprimer/cmd.glob..func4(0x43a8de0?, {0xc000148420?, 0x2?, 0x2?})
/Users/quwb/quwubin/mfeprimer/cmd/index.go:65 +0x265
github.com/spf13/cobra.(*Command).execute(0x43a8de0, {0xc000148400, 0x2, 0x2})
/Users/quwb/gocode/pkg/mod/github.com/spf13/[email protected]/command.go:860 +0x663
github.com/spf13/cobra.(*Command).ExecuteC(0x43a9560)
/Users/quwb/gocode/pkg/mod/github.com/spf13/[email protected]/command.go:974 +0x3b4
github.com/spf13/cobra.(*Command).Execute(...)
/Users/quwb/gocode/pkg/mod/github.com/spf13/[email protected]/command.go:902
github.com/quwubin/mfeprimer/cmd.Execute()
/Users/quwb/quwubin/mfeprimer/cmd/root.go:576 +0x25
main.main()
/Users/quwb/quwubin/mfeprimer/main.go:10 +0x17
Already tried to split the fasta file into several 1GB files, but still got the error.
Hello,
Would it be possible to add a flag to define the amount of cores that will be used by MFEprimer?
MFEprimer is now using all cores by default, which is inconvenient when working in shared environments.
Thanks.
When i run mfeprimer3, the program was exited with error as follow:
panic: runtime error: slice bounds out of range
goroutine 54770321 [running]:
github.com/quwubin/bio/mfeprimer.matchPair(0xc000026cc0, 0x10, 0xc0002b9040, 0xc00037e000, 0xc25d99a8f0, 0x1, 0x1, 0xc6b57256e8, 0x1, 0x1, ...)
/ext-go/2/src/github.com/quwubin/bio/mfeprimer/mfeprimer.go:996 +0x143d
github.com/quwubin/bio/mfeprimer.searchPairedAmplicons.func2(0xc57799d980, 0xc000026cc0, 0x10, 0xc0002b9040, 0xc00037e000, 0xc0001dc630, 0xd770adf130, 0xc0799da040, 0xd8a4892d80, 0xc0249fdc80)
/ext-go/2/src/github.com/quwubin/bio/mfeprimer/mfeprimer.go:678 +0x1e0
created by github.com/quwubin/bio/mfeprimer.searchPairedAmplicons
/ext-go/2/src/github.com/quwubin/bio/mfeprimer/mfeprimer.go:676 +0x208
Command exited with non-zero status 2
7498.27user 2485.25system 5:49.28elapsed 2858%CPU (0avgtext+0avgdata 123345872maxresident)k
32481680inputs+8outputs (92405major+50524720minor)pagefaults 0swaps
The database i used was 8G and finally obtain the 171 G index file.How can i get the right way to deal with this problem?
Thank you so much.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.