teichlab/scg_lib_structs

Collections of library structure and sequence of popular single cell genomic methods

scg_lib_structs's Issues

Multiome Correction

With the release of the v2 scATAC-sq kit, I think we have some additional information to supplement/improve the Multiome schematics. The new ATAC kit uses the same enzyme as the Multiome kit (ATAC Enzyme B, PN 2000265). If the schematics at the end of the v2 protocol are accurate, this means there isn't any modification to the enzyme or its adapter sequences. This suggests that the spacer sequence in the capture oligo enables hybridization of a separate splint oligo, which in turn facilitates the ligation of the gDNA fragment to the capture oligo. The splint oligo is not mentioned anywhere but I think this is the logical conclusion.

I assume that what makes ATAC Enzyme B different is instead just that it is more concentrated, a change they probably had to make to improve sensitivity in the Multiome kit that also enabled them to cut the transposition time in the v2 ATAC kit from 60 -> 30 minutes.

Question about ISSAC seq computational pipeline

Dear Dr. Chen,

I want to express my gratitude for developing the remarkable GitHub repository. I have a question regarding the ISSAC seq RNA pipeline: why wasn't the genefull option included, especially considering it is nucleus seq? Additionally, I noticed that the base mismatch option (--soloCBmatchWLtype 1MM) and --soloFeatures Gene GeneFull are not allowed. Could you provide insights into the reasoning behind these decisions?

Thank you for your time and consideration.

Identifying unmatching barcodes in Split-seq using zUMIs

cDNA tagmentation and library amplification step for Split-seq

Hi guys,

Thanks for the awesome resources for modern sequencing technologies. It indeed help a lot to understand the design behinds different technologies!

I looked into the detailed steps for the Split-Seq and got a little confused about the cDNA tagmentation and library amplification step. In your illustration, after tagmentation, there will be a product have s5 at both ends (as showed below).

As you mentioned, this product is not amplifiable due to PCR primers used. However, I think one of the PCR primers can binding to the both ends (blow is the binding of one ends, the other ends should be the same).

If this is true, this product could also be amplified solely by one primer. Could you help to clarify?

Thanks in advance.

Minjie

Questions for SHARE-Seq

Hi Dr. Chen,
Thank you for sharing detailed information about the various single-cell sequencing technologies! I’ve been studying the SHARE-seq method and have a question regarding the design of the Mosaic End (ME) primer. In the paper, the ME primer is described as follows:

I noticed that this sequence is 15bp long, while the Mosaic End (ME) is generally 19bp. Could you please explain why a shorter sequence was chosen in this case? Additionally, I thought the use of 3ddC would block the oligonucleotide from extending further, but I didn't see this effect clearly represented in the technical roadmap you shared on GitHub. Also, considering the ME sequence provided, should the Tn5 schematic also be updated to reflect this?
Thank you for your time and consideration. Your insights would be greatly appreciated!
Best regards,
Elena

Mars-Seq cell barcode/ UMI size

Based on MARS-Seq page(see RT1 primers) cell barcodes are 7nt and UMIs are 8nt.

Citing

This is an very useful resource, thank you very much.

What's your preferred method for citing this in scientific articles?

Prehaps you can do 'releases' and have them assigned a doi?
https://docs.github.com/en/repositories/archiving-a-github-repository/referencing-and-citing-content

Take care!

Little mistake

Thanks very much for your work. It helps me a lot.
There is a mistake in Microwell-seq. In the sequence TSO_LNA, the first base in 3' end is LNA-G, not rG (By the way, the authors possibly made this mistake in their article). The corrected primer should be:
5'- AAGCAGTGGTATCAACGCAGAGTGAATrGrG+G

10x single cell chromium 3' v1

Do you know in what way the library construction of 10x chromium 3' V1 differs from V2?
It would be really helpful to have the adapter and primer sequences also available for v1.

Best,
Gregor

Truseq Read1 and mixed single/dual demultiplexing

Dear Xi,

many many thanks for this brilliant resource! I had one question: on https://teichlab.github.io/scg_lib_structs/methods_html/Illumina.html, the 'Truseq Read1' sequences under 'Truseq Single Index Library' and 'Truseq Dual Index Library' differ slightly. The first one has AGAAAGGGATGTGCTGCGAGAAGGCTAGA where as the second one is ACACTCTTTCCCTACACGACGCTCTTCCGATCT (so has an extra 'ACAC' in front). Do you know which is which?

I'm asking because we often pool single and dual index libraries into one flowcell. If I then I demultiplex (using bcl2fastq v2.20) the TruSingle Index as if it were a dual Index library I would expect the 'fake' second index (i5) to be GTGTAGATCT, i.e. the first 10 nucleotides of the (reverse complement of the) Illumina P5 adapter. Instead I get GGGGGGGGGG. Is this because there is no proper primer for the 'fake' i5 index read?

Many thanks!
Philip

Want to expand the repo's utility but need git lfs enable to push on fork

Hello @dbrg77

Thank you for this centralized repo of goodies regarding single-cell protocols.

I'm trying to expand the capacities/utility of the repo.
In order to do this, I wanted to upload a large file (200M) of a 10x v3 whitelist using git lfs. it seems that I cannot do this if the main repo from which I fork has not git lfs capacities. git-lfs/git-lfs#1449

Would it be possible to add this?

"suppressiev" typos in smart-seq protocols page

Hello,
Thanks for this great resource you've made!

There are a few (5) instances of typos for "semi-suppressive PCR", written as "semi-suppressiev PCR" in the Smart-seq protocols page:
https://teichlab.github.io/scg_lib_structs/methods_html/SMART-seq_family.html

Best,
Romain

SPLiT-seq corrections

Hi,

I've noticed some differences in the oligonucleotide sequences for SPLiT-seq between different protocol versions.

This is the structure of read2 based on the preprint, which matches what you currently have:
[10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCGCATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAGCGCGCTGCATACTTG[8-bp Round1 barcode]CCCATGATCGTCCGAAGGCCAGAGCATTCG(dT)

This is the structure of read2 based on the published manuscript:
[10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCGCATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAGAGGCCAGAGCATTCG[8-bp Round1 barcode](dT or N6). This sequence ends with either poly(dT)VN or NNNNNN depending on if the oligo primes off poly(A) or random hexamers. I don't know why the oligo design changed between preprint and acceptance.

Finally, the oligo design has changed again in the commercial version of SPLiT-seq by Parse BioSciences. This is the new read2 structure:
[10-bp UMI][8-bp Round3 barcode]GTGGCCGATGTTTCGCATCGGCGTACGACT[8-bp Round2 barcode]ATCCACGTGCTTGAGACTGTGG[8-bp Round1 barcode](dT)

As far as I can tell, all three versions have a 6 bp i7 index between the Illumina TruSeq and P7 sequences.